Description :
From Genome Similarity Track
Location :
Scaffold_23:26512- 33902
Transcript NameFunction/comments
Phypa_INRA-310PPTG_10733hypothetical protein
Phypa_INRA-310PPTG_10734hypothetical protein
Phypa_INRA-310PPTG_10735hypothetical protein

Sequence
7390 bases(100 bases per row)
TCGTGGTTTAACAGGTCGAAGGTGATGAACCTGGTTGTGTGGCGTGGTCGGAACTCCGTGAATGTGATGGCTGCCAAGGCGGATGTGGCTGTGCTGCTGG
GAACGATGAAGGAGCTTAAGATCTACAACTCTGCCGTGCAGGAGGCTGTAATGGAAGCCAAGAAGGTTAAGGACGAAGAGCGTGCTGCTCGTGACGAAAA
GAAAGAGGTGGAGATAGAAGAGGTGAAGGACGAAGGCAAGAAGACAAACGCTACGCCCGCCAACTAACCAGGGGACGGCAATCAGATAAAGGCTCCACAG
ATAGACATTGCTCTCTAACGCGTAACAGCTTTGCACATCAACTCAACGAACTCGTGTATTCTTGTTTGAACGGATCGAGGACAAGCAGCACTGCCATAAC
TATCTGCTAATTTTGAGTCGATATGGTGATAGGAATAGCCGCACACGCTCTCGATGGATGGAGCCTTCCAATGCTCCGCAGTTTATTTCTGCTCAAGACT
GGAGCAAGATCGGTACCGATAACCTGCTTGTGTTCAAGCAATAGGAGATTCAACAATGGAGCGGAACTCGTCGTCGCCAGCTGAGATGCTCAGGATGCCC
GAGCACCCTAGCACACCAACGTTCACATGGTACGAAGCCGCGAATTTTTCATCTTTTCGTGTACGTAACTTTGACTTTTTGTACGATGAATGATGCAGTG
AGGTGTGCAAGATATCGGTGCGCTCGGCGCAGAAGCTTATGGATCACGTGAACTTCTCGCCACTTCATCAGGCTTCGCTCGGTATGAATAAAAACACGAA
AGCTCGTGCCAAATCTACAAAGCAAATGCGTAAATTGCTGTACGATGGCTCGAAGCTGTTCTGGCGCGTCAATGAGACGCTAGATCTGTGCATCTACGAA
GATGCGGCGGTAAACACCATCACCATCCGAGCGTTCCAGCACACATCGCCTCAGGACAGTGACCCTAACAACTCTGCAGACCCCATTCCAGCTCTGGATA
TCGACTCGCGCCGCTTGCGTGAAACTCTCGGGATCGAGACGGCTCCTAAGGCCTCTGGACAACATGGAAGAATGGCGTATCCTCCAACGAATACGATGTC
AAGCTCGACGCTCCCCAAGGCAAATGCTGACGCATCGACATCAGCGCATTCAAGCGAGTTAATCACGAAATATCTACTGGCTCGGCTTCAGGCACGGCGC
GACATGCTGGACCGAGTGAACCTCTTCCTGCAAAAGATAAACGACGATGAGGTGGATCCAGCCGATCTCTTGTTGACCACAACCGGAGGTTCTCAAGCAC
TACCCACCGACCTCGAGATTCGCCGTCGCCACACTATAGATGACGTGAAAGACGCACAGAAAGAAGTGTCTGTGGCAACCACGCGGTTGAAGAACGCACG
CATTAAAGCTGAAGAGCTCTCGAACCTAGCGCGACGAACGCTTGATACTTTTTCACGACAATATGGTTCGGCCTCTGACGAAAACAGAAGAATCGCACGA
GAGAGAGCCAACGTCAGTGCATTGGCAACCTCTGCGTCCAACGCCATTCTGGGGATGAATGGCGGTCGCCGTTTTACTATGATGGACAACAAGCCTGCCG
CTGCTTGGATGCGTGCTTACGATCGAGTGGTGCTCCAGAGCGCCGTGGAGCGCAGCAAAGATGTGATCGACAATCGACCTCAGTACGAGAAGAACGCAGG
GCCAATTGACGAGACCAAGTAACATTGAGAACGTTTCATTACCTATTCGATAACTCGTTTGCTTGAACCCGTAGCACTTTTGTTGTTTGCATGTCGAAGT
TGGAGGAGGACTAGCAAGTTGATACGTAGCGCTTCATTCATATGAGTGTCAACAAGGTACTGGTAGAATAATTCGAGGTAAACTTTTGTTCTTATTGTCG
GTGCATTTGTCAACAAGCTAGGGTTGATTGCTCTTGCGCGGGTCGTCCCAGGTTGTGACCCGGTTAATGTGGTCGATATAGAATATCCTTCCTTTGGCGT
CGGTCTTCTCTTCCCAACCGACTGGGAGTGGGGTGGCACATAGTGGCGCTGCGTCTAAATCACTTCCCGGAGACGAATTTCGTGTGGCATCTTCTCTCTG
CTGACAAATGTACTGCAAGAGCGCTTCGCAATAAAGATCGCGAGCATCTTGGTTTGAGAAATTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTTAAACGCTTCATGCATCGACTTAGGCGATGGCAGGCTGTATTGGTAGTGC
AGCGAGTTGTTCGTTGTTTTCTGTGGAGATCGCGTTGGCAACGATACAGACAACAGGTGAGGAAAATGTTAATTGCAGCAGCAAGACAACAGCAACTTGC
ACTGGCGACGGAAACTTTTCAGCGAGTACGCGAGAATGTTTTACTTCAGCGTCAGGCAGAAACGTGGAGTTCTCATTCAGAACGAATGCAAATGTTGCTG
CGGGTACGCCATCGCAAGCAGAACCTGCAAGTTTCTCCTTCATGTACGTGTATTGTTCCCCCGCTTCAACGTATAGCAAAGTGCAGTATACCACCAAAGC
GTAGTAAGAAATCGACCAGACCTGTCAGACAACAACAACAGAGCTTACCATCCATCTACTCAGCCAGTCGCGGAGAGTAAGCTTGGTGTTATATAGATTC
CAAACTGATTCTCAATGCCTATCGTAGTCTGACTCGCAGCCCCTGAGCTGATGAAAATACGATGATAACAAAAAATGTAGAACCCTGAAAACATTTTAGC
AAAACTCCAAAATATTCCAAACCATTCTTCACTATTTCGAGTAACCTGCTCGAAGGCTGCCACAAACTCGGGATATAGCGTTGGCTACAGGACAAGTTGA
ATGCCCATTCGACTCGGATAGCATATCAAATCTTTCGATGACCACATCCAGCAGCATTGGTGGCAACCAGTTTTGGTGAATGAGCCAAAATTGTTCGAGA
TGCTTCGCAAAACGTAAGAGTTCTGGACGATGCTCCTGCTCGGTAGACCTCGCAAAATCCACTTCTTGTGATGATCCAACGAGATCACTCTGCCCATGTA
TGTTGAGTGCCGTGATGGCTTTCAGGGCTTCGCAGAAATTATCCATATTTTCTAATATATCGCTGCCCAGTGCGTTGATCCGCTCTCCTGTAGTCGTTTC
CAAAAGCTCGTCGTTGTCGTGAGCAGCCACTAGCTGCGTAGTAACACACACTTGCGTTAGTGCGGCCTGAAAAAAATTTCGCCGTAATTCCAATTCAAGT
GCACGGTGTTCCAAAGAATTGAGTGCCTTGCAGTTCTCGTAATATGTGGACTGCTCGTCACTGGTCTTGTTGTACGTATCTTCAAACACTCTCAACTCCA
GCTCGTCAGCGTCAAACCACTGCTTCTCTGTTTCAGCCCGGCAATCGGCCATAATTGCTACAAACCTCTCTGCTGCACTCTGCATTTCATTTTCATACTT
CACCATTGCATCTTGGATGTTCTCAATCTCGCGTGCGCAGTGAGCACTCATCTTTTCCAACCTTGACATGATAACACCCACTACACACGCTCTGTATTCG
CTGAAGCGTGCAAGTTCTACGACAAGTGACTGCCAATGATCCATTAGCTGATACAACTGATCGATAGCGTAGTTGTCACCAGCTACGAGAGCGCTTTCCT
CCTTCCAGTGCTCTTGCTTCGCCTGTGTCTGGTATGGCGCGGTTTGTGCTAAACTCAGCACCTCGCACACTACCATTACCAGATCTTCACTTGCCCGGAA
CCGTCGATCGTGTCCATGTAATAGCGTCAGTAGCTCTCCTAACTTCTCGCTCGTTGCTCGCAGTGAACGCCGCACCACAATTGATGGCGGAATGCCGAGA
TCGTGCAGCAGTGTTCCCAGTGCTTGTTGGTCGTCGCGCAGCTCGCGATTCTTGGCCAGCGTCAACAGTCTGTCTGCCACATCAGTCCACGAGAATGGCT
TCAAGTCGTTGGTGATCGGAACTTCCTCATTATCTTCACTCACGTCGTCGTCACTGATGACGATCACTTCAGGGCTGGGATGTGGTGGGGCAGCGTCATT
TCCCACTGCCTCTGCACCCTCCATCGCAGAGTATTCTTCACTGTACAGGAGACGGCAACGGAGCTCGTGTCTGTTGATTGAATCGGACAACTTCAAATTC
ATATCATATCGATTTGCAGAGGTGTAAACGTCACTCTTTAGCAAATGTCATTCTAAAGGGGTAACCGAACCGTTCTTGTTCCGGTCCCAATTTCTAACCG
TCGAGCCAGTGGCCGCATTCCCCCCTTTCTCCCAGAGAAAAACGACAAGAAACTTCCCATACATTTTCAAAGAGAACAGAACAGCAAAACTACAAGAAAA
GAGAAGCGCTTAGTTAAAGCGAGAGCGGTGGGGGTTGATTGTTCCTCCCTTTTACTGCTGCATTCCCCTTCAGCCGTCAGTGTCCCCGCCTCCGTCTGTG
TGTGTCGGTCGTCTGTTTCCTTTGCATTCCGACTCGCCGTCCGCTCAGTCAGTCAGTCGACCGTCTGGCCGTCACGTTAAACGTCGCTGTCCGTCCAACG
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN