Description :
From Genome Similarity Track
Location :
Scaffold_1674:2651- 3745
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_1674-fgenesh-gene-0.1Chloride Channel (ClC) Family

Sequence
1094 bases(100 bases per row)
TCTTGTCCCTCGTTGTGAAACCACAGAAAACCGTCGCAGAGACAGAAAGAAAAGGCGAGAGACAAATGGAACCCCAGCGTCTCCTGCGCATCTCCGTCGT
CGACGAATCGGCGCTGTCGCCGCGCATCGCCGACGACGAGACCGGCGGCGACTGGGTATGGCAGCCGCCCAGACATCGCCGNNNNNNNNNNNNNNNNNNN
NNAGATGGGAGCCGCTCGCCCACGCCTCTCCACGAGCTCCAGAGTCCAGTGGTGTTTCCGAATGGCCGCGCAAGTGCCATTGCAGCCAACGGCGGCAGTG
GTAGCCGCACACAGTCGCCGGCATCCTCAGCACGCCACACGGGGATGCGCCAGCGCAACTCGTCATCGCCCAGGTCGCGCGGTGCCGCCGTCATGGAGAA
GATCATGAATCCGCCGCTTGACCGCGAGACCCCGAGCGCCGTGGACGACACGGCGTCCTCGCCACACACACACCGCCTCGAGCGACCAGTATCGAGCCAC
ATCAAGGCCTCGGCGTTTGATGATGACTACCACTCGGTCTACGTCGCGCAATATCCTGGTGGCCTGAGGGGTCTGTTCGTGCTCTTCCAGAGCCCCCTGC
TGCTCATCGCCGTCGGTCTCTTCTCGGCGTTTGTCGGGCTCTTTGTCGACTTTTGGCTCGCACAGATTGCCGCGTACCGCAACCAGCTCACGGATATGGG
CTTCCGGTACTTTGTGTTGTCGGCGCTGGTCGCCGCGGGCTTTGCGACCGCCCTCACGCATTTGATCTGCCCGCAGTCGGCCGGCTCGGGACTGCCCCAC
ATGCGCGTCGCGATCTCGGGTGTCGACATGAGCGAGTACCTCACGATGCGCTGCATCGTGACCAAGATTGTCGGGCTCGTCGCCGTGTTTTTCGCGGGGC
TCTCGGTGGGCAAGGAAGGGCCGTTCATCATGATCTCGTGTGCGTTCGCGAGCGTGCTCATGCACTTGCCGCTCTTCCAGCGCATCAACAGCGACGACAA
CAAGCGTCTTGAGATGCTCGCGTGTGCGTGTTCCGCGGGCGTCGCCGCGACCTTTGGGTCTCCATTTGGAGGCGTGTTGTTTGGCGTCGAGGTC