Description :
From Genome Similarity Track
Location :
Scaffold_239:26509- 28204
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_239-snap-gene-0.15NAD-dependent epimerase/dehydratase

Sequence
1695 bases(100 bases per row)
CGGCGAGCGCCTGCTCGACGCTCACGTCGTTCGCGGGATCCCACTGCGCGCCGTCGAACACAAATACATTGCGCTTCGCGCTGCTTTCGTTGGCATTATC
AGTCGCGTGGAAGACGTCCGGATGCTGCGCCGCCAACTGCAGCGCCGACTCCTGTGTGCGCGACGTGCCCGCGACTTCAAAACCCTTCTTGCGGAACGCG
AGCGCGGCGCGCGCAGCAGAGAAGCCTAAGCCAAACACGAAGAGCTTCTTGCTAGCACCTCCAAGAGAAGCGACAGCAGGTAACGAAGATGCAGATGCCA
TAACGCGCGGGTCTAATGGTGTGGATGCAGATAGAGAAGGAGAGCAAGCTGCTTCGTCAAGTGTCGCTCGTTCTTCTGCGTTCTTCCTGAAAATGTGTCA
TCGATTTTTGGTTGTGCATTTTGATCACAAATCACAGTAGACTCAGATCTGATTCTACCAGCTATCTGGTATTTACAGAAAAGAGCATCTTTTTAGCCAA
AAATGGCACCACGACTTTCGTTTTTGTTTCAAAATTAGAAATCAATGACATCCATTTCTTGTTTTGCGTTTCATAAAATGACAAAACCAATTTCATGAAA
ATCGGTGTGACAACGTGGAAGTATGGCAGCAAGTCTGCATTTCAAGTCTACCATTTACTGTTGTGATGGAGGCTGTTTCATTGAGAAGAAGACGAAGGCG
TGCACACTTTCGATGTCTTTCTTCTCTTCTCCTTGCTGCTTTTCTTCTTCTGAGAGTGGGGATGCAAATCAATTATAAATCTCACACACTCATCTGCTTT
CATTCTGTGTCGATGGTTACCACATGCATGTCAAAAATCACGGATTCGCTGGGTCGTCCTGGGCCAGGCGTTTGGATGTTGGCTTGACCCCATCGACATA
TTCTTTGTACTCTGCTAACAACACTTTAGTAGCTGCTCACCCACATGCTTGCCATTCAGGAACGATAGCCCATTCATGCACTAGATGTCTCTGCTGATGG
TGTTGGCACCCGGTCGCTCGAGGCGGTCGATGAGACGCATCAGGAGCGTCGTGTTCGCCTGCATGGACGCAACGAACGCCGAGCGCTCCTCCCGCTCGCT
CTCGAAGCGCGCGCGGTCAAGCTCCAGGCGTCGCTCCGCGAGGTCGAGTTCACGCGCTTTCAGGCGGTTCCCGGAGATGTCGCGCTCGTCCAAGTGGTCG
AAATCCGCGCGAGGTGGCGCCTGGCGCTTGACGTCTGGAAGCGCCGCGCTTGGCTCAGATCGAGGGTGCTTTACCCCAGAGAACATCGACGACGGCGATG
GTGACGATGATGTCGTCGTCGACGAAATGATAGAAGAAGGAACACCTGCTGCTGCTGCTGCAGCGGCGGCAACTCCATTCGCCTGTTTCTTTACCTTCAA
CTTCTGGTCATGATGCTGCGAAAGCTGTATGCACATACTCACACATCGACACACAAATGAGCGCTTGCAGCGAGTCATATAACAGCAACAGAGGACGCTA
CATCACCTGAAGACTGAGGTCCGTGAGCAGCTCCTCTCGTCGCACGTAGAGGTCCGGCGAGCCCTTGGCGCGCATGGACTTGAGCTCGTCCTTGACGAAC
GCCTCCATGAGCGAGTCGTAGCGGCGCTTGGACGCGCCGTGGTCCACGCGCGCGGCCTCGCTCTCATCGCGCGAGCTGTTGATCGTCGCGGTGAC