Description :
From Genome Similarity Track
Location :
Scaffold_1359:2650- 5044
Sequence
2394 bases(100 bases per row)
TAACCTATCCACAAGGTGGATCATCTCTTCAAGATCGACCGATGGGCGGTGAACGTGAACGTTTCCGTCGTGGACGCCGGCGTCGTATGGACGCAGACGC
CGTTTCGGCAAGTGCTGACTCTCCCCGCGAGAGCCCAGCTGAGGCAAGGCCTCCTCCTGCTCTGCTCGATGAGCATGGTGAGCTCCACTTTCACGTGGAA
CGCCTTGTGGCGTGGCGTAGACGCCAGGGTCATACCCATTACTTGGTGAAGTGGAGGGGTTACCCTCACTCACAGAACTCATGGGAGTTTGAAATTATCC
TCCGGCAAGAATGCCCTGACGTCGTTGACGCTTACGACCGGGCACATCATGTGCCGAAGCACCACCATGGCGTGCGACAGCGTCGCCAGGCGCTGGGCGC
CTCCCACTAGAGTGGGGAGCTATTAGATCAGTAGTCGAGCTCAGGCTCTGACCAGTGGCCGCAGCCGTATGAGCGGTGCTCGCAGCGGAAGCAGGAGGTG
GAGAGATCTCGTGATGATAGGGACATGGTCCCGAAGGAAGCAGGTGCTTCGTGTTGTGCTGAACAAGGTTCAGGCACAAGCGTCTAGATAGACGCATAGT
TGTTTTGAAACAACTTGCTCGATGAGCATGATCCAAATGTGGATGCGCTGTAACAGCGAAAGTGGTGTCCCGGACGGGGATCGAACCACTGGCCTTTGGC
TTGACAGGCCGGAGCTCTACCATTGAGCTATAAGGGCGATGCCCGTACGTCAGTCCGAGAACGGACTATTCATGGTATGAGAGGGCTGTGCCCGGGTGGA
TTTAAACCACCGACCTGTGGCTTCCAAAGCCAGCGCTCGACCACTGAGCTGAAAGGGCGTTGCCCTTAAGCTTGTCCATTCAAGGACAACAGGTCATGGA
ACGAGAGGGCTGTGTTTGGTGGGTTCGAACCTCCGACCTGTGGCTTCCTAAGCCAACGCTCGACCACTGAGCTAAAAGCGGATTGCTCTTAAGCTTGTCC
AAGCGTGGACAATCGTTCATGGAACGACAGGGCTGTGCCCTGGTGGGCTCGAACCACCGACCTGTGGCTCTCAAAGCCAACGCTCAACCATTGAGCTAAA
AGGGTGTTGCCCTTAAGCTTGTCCAAGCGTGAACAATCGTTCATGGAACAAGAGGGCTGTGCCCTAGTGGGTTCGAACCACCGACCTATCGCTTGTGAAG
CGAGTGTTCAACCGCTGAGCTGTTGTCGACGACTCGAATGAGTCAAGAGCATTGCTCTAAGCGGTTTGTAGCTCTTGGAGTAGGCGCGGAGCGCGAGCGT
AGGTCTGAGACCGCTTGAGAGCAAGATGCGCGCTGCGCTGGGAGCATTGGGCCGTGGGCCGACGACGAGAAGTTGGGCATCAACAATGCGTAGGCGTTTG
TGAGCTCACGGAGCTGTACAACGCTGGTGTGAGGTGTAGTAACCTCCGCCGTCTTCACAAGACGTGACCTCGCTGAGGAAAATTTCGAGAACGGAATGTT
CTCATCTTAGTGGGGGAGAGTGTAACGGGGTTACATGGTGTGGAACACACAGGGGTACGAAGTACCCCGAGAGTTAACAAACTCTCAGTACATAAGTTGG
AGAGTTAACAAGGTCTCTCAGTACGTTGGTTGAAAGCCACACGTTATGCATTTGATTAGGTTTAACTATGCTAGATAGTTAAACAGATACATTTACCCCT
AGGCGGCTTGGCCGCAATAATAGTAAATAAAACACTTCTGGTTTTGAAGCATAAAGTTAAGGTATTAACTTTGAGCCCTGGTCTTGGGCTGTAAGTGTCC
TTTGGATAAGGAACTTAGTATTAGTGACTCTTTGAGTCGAACGTCTTCCTCTGACGCTAAAGCTACGTCAGCCCCGCTGCAAGCACGGTGTCGGTACAGA
TTCTATCGAGCCACATATTGCTGAGCAAAGCACTACCGACGCACAGGTTGAGTCTGAAACCGCACAGCGAGGAAGGGTTTACGTTCACGTGCTCATGCTT
CACATTGTCGGATCTCGTGAGAATAGAGTGCTCACAGGGCACAGCGTGGAGCTAGCACCGTTCGACGTGATCATGGTTCACGCTCTGGTTCACCATCTTC
GTCTCGATTTGCCACGTTAGAACGTTGGAACCTCGCTTACCACAAAAGCCAACACTGCAACTAGCCTAATAATTTGTATTAATATTGAACATCCTATAGC
GTTTTTCTCTTCGAGATCAAGACACTGTAGCTTCTACAAAGCAGCCTCTCTCCACGAGCACAAGTCATCCAGGCTTCTACATCGGCAGCACTCGGACGTA
ACTTAGGGCTACGTGATACGCAAGCTGCGATTGAGTGCGTGATCGGCACGCGTACCGCTCACCGAGAACCAGAACGAATCCCATCGTAGCGAAT