Description :
From Genome Similarity Track
Location :
Scaffold_573:265- 1724
Sequence
1459 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATATTTAACTATTTCGTATTG
TACTAAATCGAAAAATCGAACTGAGAATGTGAGCCACCTCACAACCCTAGGTGATAGGTGCGATGAGTTTATCGCGGTCCACATTAATTAGTAATCTGTG
CAAACTTCAGAAGGATCGGTGCCCGATAGATGCACAAGAAAATTCGCAAGAGCATATTCTACAGAACGTTTCCTTGTCATGCACTCCTTGTCGTGCACGG
GGTAATTCATCTCCGCGGNNNNNNNNNNNNNNGGCTTGATACGAGATGACACGGTCAATGCCGTCGTCATCTCTTTGCATAAGTGCCACGCCAATGGCGA
AAATACTCGTATCGTACACAACACTCGCGTCTGGCAATGCCAAGACTGGAGCTTCTAAAAGTGATTGCTTCACCGAAGTAAAAGCATCTACTAAAATCTT
ACACCAAGTTCATAATACATCCATTTTTAGGAGGTCAGACATTTATTTAGGTCCCTCTGCAGGATTGATTTTGTATTTGTGCAAGTAATTAGCAAGCCCA
AAGAATTGGCACAGGCCCTTCATATGTAGTGGGACTGGCCATTCCTTATGGCCTTAACATTTCTAAATCTGCTCGGACACCGTGCTTTCCCACGATGCAT
ACCAGTACAAATATCTTGTGGATCCCTCTAAAGCACTTTTGCACATTAACGTGCAGTTGGGCGCCGCCAAGAGTCTTCAACATAACGTCCGAACGACGTT
TTTGCGCTTCAATCTCACTCAATCCGTTCTCGGTCTCAGTATGAACGAAATAATTGTCAAAGTAAGAGGTGCATAGGTACAATGTGGACGCATCACATGA
GCTACCACCCGGTTGAACATCGCTGGTGCGTTTTTTATTTCTTGCGGTTTCACTAGCAACTTCCACATCATAACGCATGGGGTTATAACTGCCGGCTTGG
CTACATCAGTTTCATTGATTACTGCCTGATAGTAGACATCCTTCGAATGAAATGCGGAAAGGATACTTGACTTTCCTATTGAATTCAATAGAGCATCGTT
CCGCTAAATAGGAGTTTGTGCAAGGATGGTGGCCGTGTTCAGCTTATTGTAAGAATTAAATAAGCTAGACCACCTATTGCCTTATGCACACAAAGATCGA
GATGCAGTACGTTGACTGGCTCTCACGTACATGTTTCACCTTGGCTCGCTTCTCAAAGAACTAATCGATGTTATCAACCTGTTCCTTCGGCAATGGCCAC
TGCTGCCTGGTTACACATTACTTGGTGCCGTTTTTCCAAGTCAATATCGTGCCTGATACCCTTTATCGACCGGTAGGTGGATCGGCACTGCTGGAAAGAT
ACCACGGTGCTTCCACAGAACCTCATAGTAAGATATGCTATCAGAGGCATTCCAGCCTT