Description :
From Genome Similarity Track
Location :
Scaffold_1189:265- 1398
Sequence
1133 bases(100 bases per row)
CGTTTGCGACTGTGTGGCAGAGACTTCCAGACTATCAAAACCCATCCTAGACAGGCTACAGAACCTCACAGACCGTCTTCCAGTCAAGCTTCTGTTCTGC
ATCGCTATGGCCATCATGATCACACACAAGCACCCCCGACTTCCCCAGGCCGATGTGATCGCGAACGGTGCGATGGGGACAATAGTCGTTTTTACGCCAG
TCGACAATGGCCCGTCCCAAGTATCCGTCATTGACGGTGTTCGGTCGAACAACTCGAGCGACATCCAAAGTTCCCCTTTGTGAAGATTGTGTCATCATTC
ACACCTCTCGTGGACGGATTCCTCCGAAGAGTTATCGGGATCCCTCCGCTCAAATGCGCCCTTAAGTTGGATAAGATTCCGGACTTAGCTCGAGCGACCG
TGACTCTGGAGCAGTTCCCGCTTGTGTCAGCGTTCGTATGTACAACGGAAAAGCTACACGATCAGACGTGTCACGACGGCATCATCTTAACTCGACTCGA
GCGAGGAAGGGGAACTCCCCACCAGACACTATATGTCGCACTATCTCGCTCAGTTACGCTCGAGAAAGTCAGTATGCTGGAACCGATGACGCAGGAGCAC
GTACAGCGGTTCCGGCCCACGAAGCAAACCTTGAATGAAATGGGGCGCCTCGTCAAGCTTGTTTTGATGCCACCTTACGCCCCTCCGTCATCCAGTCGGA
CTTCCTTATTTGGAAAGCGATACAAATGAGAGTAGGTAGTCAGTTTTAACAGAACATGCACCGCAACCATGGGACCTGTTTTCAACACTTGGGCTCTTCT
ACGGCAATCCGTGAATAGCATTCAATCTTCGTGCTATATCGTCGGACAATCTTCCAACTCGAGTATTCATCGGTGAACCGACCAGACCTGAGAAAACAGG
ACTCAGTAGGCTTGTAGTGGTAGATGCCACCGTCGCCCGCGGAAATGCAAGATGACGCCGTCTGGGCCTTCACGGTATATTTAGTCGCTGAGAGACCCTC
GCGCCGAGCAACGCGAGCACGCCACAGTCTTGCCATAACCACAGCCCACTATTCGAAGCATTTTCGCTGCATTTTTCCGTGTTTATAACAAGACAACTAC
GGTGCCGGTATACCGGTATACTACCGTTTTGCT