Description :
From Genome Similarity Track
Location :
Scaffold_1159:265- 1320
Transcript NameFunction/comments
g12887.t1hypothetical protein

Sequence
1055 bases(100 bases per row)
GGACAAAATAAACCGCCTTTCAACAACGTTTCTTTTCATTCCCATACGTGGTCGAGTTTCAGAGAGATTCCAGGCAAATTCTCCCGGTGGTGAAGGGCGG
CTCGGCGACAGAGACAATCGACGCATGCCTGAAGTCATCCGAACGGTGGCCACTTTTCCATACGGTGCGTCTGACAGAGAACATACGGCTGCCACGTCCG
ATAGTGCTGCAGAAATGGCTGCGTTTTCCGAGTACCTGCTGAAGGTTGGAGAGGGGAGACACGAGGTACACAATGATCTGGGAAATGACTACATGAAGAT
TCCACGTGACATGCTCATCGACAACCCCGCCGGTGATCCAGATGAGGACGAGGAGATCCGACCGGGAGCTATTCCGCGAGGTATGCGGCGCATGATCGAC
GAGATGTACGCCGGCATCAACAATTCGGAAGTCGCAACGGACGAGTACTTTGCGAGTCGCACCATCCTCACCACCACGAACGCGATAGTCCATCGTATCA
ACGAAGCCGTAGCGGATCGCATGACTGGGCCAGCTCGAGAATATGTGTCCACGGACTCAGTGGAGGATGACGAGGACGGGAACTTATTCGAGCAGGTGCT
CAACTCCCTGAACATCAGTGGCATCCCACCCCACAAGCTGAAACTCAAGAAGGGGATGCCGATCATCATGATGCGGAACTTAAATCCCGACCTGGGGTTG
TGCAACGGAACACGCCTGCGAATCGTCGAACTCAAAGATCATGTCATCCATGCCACCATCATGGCCGGCGACAGGCACGGCCAGCATGTGTTGATCCCGC
GCATCGTGTTCATCAGCGATGGCGACATCCGCGATTTCCCATTTTGACTGAGACGCAGGCAGTTTCCTATCCAGACTGCCTTTGCCATGACGATCAACAA
GGCGCAGGGACAAACGGTGCAGTACCTGGGACTGTACTTGGCGACTCCTTGCTTTTCCCACGGTCAGCTGTATGTGGCCATGTCAAGGGTTACGTCGAGG
TCGAGATTCAAGGCGTTGGTCGAGTATCCAGAGCGGGAGGAAGAAGACGGAGTGT