Description :
From Genome Similarity Track
Location :
Scaffold_152:26499- 29300
Transcript NameFunction/comments
Physo_143797hypothetical protein
Physo_124234hypothetical protein
Physo_143798reverse transcriptase

Sequence
2801 bases(100 bases per row)
GTACGGCTTGAGCAAGCCCACGTAGAAGACGGGGTGCGTCCGCATCTTCTTCGGAAGATTGAGTGTGTACGCAAGGCCCTTCTTGGCCACAACCTTGAAA
GGTCCGATGAAGCGCGGGCGCAACTTCGTCTTGAAGACGGCTGAAACTGCATGTGTAGGTAGGTTCTTAGCGTTAAGCAGCACCAGGTCCCCGACCTCAT
AACTTTCAACATTGCCTCTGCCTCTGGCATCTGCATGTTCCTTTTGCTTGTCTTGGCTTTCAGCCGTTGGGTCACGCGCATGTCGTAAGACACTCAGACG
CGTCGACAAGAAAGCGTCAACCTGTTTACGAACAGTAGCCGGGCTGACATCGGCTAGCCGATCAGCTAAATCGGATTCCCCTCCCCCACCAAGCCCGAGG
CCACCACGTGGCGGTGTCAGCGGGACGCGGGGGTGAGACAAGCTGTTCACGTAGAACGGCGTGCAGCCTGTCGAGGTGTGCACGGCGTTGTTCAACGCAA
ACTCAACGAGTGGCAGCATGGCGCTCCAGCGCTTCGGCGTCTCAGCGCAAATGCTGTGGAGCACGTCCTCGACGACGCGATTTACGCGCTCTGTCTGACC
ATCGGTCTGCGGATGGTCCGCCGTGGACATGTCCAGCTTGGTGCCAAGCACCGCAAAGACCGTGCTCCAGAAGTTACCCGTGAAGCGGGGGTCTCGGTCC
GAAACAATCGACTCAGGGAGTCCGTGTTGTCGAAACACTCGGTCCAAGAACAGCGTTGCTGTACCTTTACCATCGATGGTATCCGGCACAGCCGCAATGT
GAGCCATCTTGCTCAGTCGGTCCACGTAGACCACGACTCCAGTGTTGCCCGCCGCAGGCCAAACACAAAGTCCATACTCATGGATTGCCAACAGCCCAAA
GGGATAGGCAAACTCGCCAACGGCGCTGTGACGACTTCACTCGCTGACACGTCTCGCAAGTGCGCACATAAGTGCTCGTCCACTTGTACAGCTTCGGACA
CCAGTAGTGGGTGCTCATCGAGCTGTAGATCTTCTCACGGCCAAGATGGCCGGCCAGTGGCGTGTCGTGTGCCTCATAGAGGATGCGGTACTTCAGATAC
TCATCATGAGGGATGACCACGCGGGGCGTATCCTCGGGGCCCGTGTTGTAGAACAACAGGCCACCATCGAAGGAATAACGGTGCAGACGCGCTGACAATT
CTATGTCCGAGCCTTGAAACTCCTTGCTCCCCAGAGCCTTCAGCAACGCGACACAGATGTCGTCCTTGGCATAAGCCGTTCGGATCAAATCCGGTAATGA
CGACGTCACTGTCGTTACATGAGCCAGATCGTAATCCGGCCTGCGCGACAGCGCGTCTGCAAGGACATTCTGCCTGCCAGGCTTGTACTTTACCTCGAAG
TTGTACTCCGCGAAGAAGGACAGCCAGCGGGTTATCCTTTGCGAGAGATGCGACTGAGTCGCAGTGCGTAACGCCGCATGATCCGTGTAAATCACGAACG
GCTGAGAGCCCAACAGGTGAACCCTGAACTTGACGAGCGCATACTTCATTGCAAGTAGTTTTCCGCAGCCTTTAGCTGGCGAGATTCGAACGCCACCTCG
CGCTCGCGCCCCTCGGCGTCTGCTTGCAGCAGGGCACAGCCGATGGCAAAGTCCGAGGCGTCACAGACAACACTAAACGGACGAGCGGGGTTTGGCAAAG
CCAGAATAGTCGCATGAATGAAGGAGACTGTCCTTAATAGCCGCGAACGCATCTTGATGCTCGGTGTCCCAACACCACTCCGCATCCTTCTTCAGGAGAT
TGGAGAGTGGCCGAGCCATCTCAGCGTAGTTCTCGCTGTACTTGTGCAAGTAATTGGCCAAGCCAAGCCACTTGCGAAGATCCTTCTGGTTCTTGGGAAC
CGGTCAGTCAACAATGGCTTTGACCTTGACCGGGTCGGCTCTCAGGCCACGCTTCCCAATGAAGCACCCTAAGAAGGGGATCTCTTCCGCTCCGAAGATG
CATTTGTCAATGTTGGCGTACAACTTGTTTTGACGCATGCATTTGAGCACAGCACGCAGGTGCTCCACATGCTTCTCCATATCAGTATTTCCGTGCTCAG
CACGACTGTGGACAAAGATGTCATCGAAGTACGTTTGCGCGTACGCCCGATGGTGCCTGAAGAGCTGCGTCACAAGACGCTTAAACGTCGCTGGCGCGTT
TGAAAGCCCTTGGGGCATCACCAACCACTCCCAGAGCATGCCGCTCGGGCTACTCACCGCAGTGAGAGGAATGTCGCTCGTCTGCATGAGCAATTGGTAA
TATCCATCGACCAAGTCGAGCGCACTGTACATCGTACATCCTGTCATGTTGTTCTGAAGAACATCCTTCCGAGGAATCTGCGCCGGAATGGTAGCGGCAT
TCAGCTTGTTGAAAGCACGCACGATACGCCACTTGCCATTCGGCTTTCTGACACAGAACGTCGGCGTAGAGTGTGGAGACTTACTCTCACGCACCATGCC
CGCCTCGTGCTTCGCACGGAAGAACGCGTCAATGACGTCACACTGCTCCTTTGGCAAGGGCCACTGCCTCGTCACGCAGTACTTCGTTCCCGGAACGAGA
TCGATTTCGTGTCGAACACCTCGATCCGGAGGTAGCCCCGAGGGCGGCTCCTTCGAGACCACGTCCTGGTAATCCTTTACCACTCGATACAAGGCATCCG
ACGGGTCCTTAAGGATCGCCGATCCGCTCCGCACATTCAGCGCCTTCTTGGTGTCTTCCAGGACAGCTTCATCCAGAAGCGAGGACGCGTTCAACTCTTC
T