Description :
From Genome Similarity Track
Location :
Scaffold_1:264981- 266284
Sequence
1303 bases(100 bases per row)
CTCGACGGCTTCGCAATACTCCTCCATGCGGGCGCTAACGATCGATTCAGCCATGAACAGCTTGTCCGCAAACGTGTCGTGCACGTAGTCGATCATGTGC
AAGAATACACGACACAACCACGCTGTACCCCTTCCAAACGTCTTCATCGTGTCGTAGTAGCGCGTTGGAAACGCTAAGCGAGCTAGCATCACGCAGAGGG
CAGTGTCACCGGAACAAGTGTCGCCATGTGCCGTCACTTCAGTGTCAGGGATGCGCAGCAGAGACCGTAGCTCGTAGACGCCAGCCACATCGAAGCGAAA
CTCAAGCTCGCTGTTTGCATCGGTGTTGCTAGCGAGGTCAAACGTCACAGCAGGAATCGAAGGCCGCTCAACTTGGTCGAGCAGCAACATGAAGCGAAGC
TTCTTCTTGCGGCTCATGTACTTGTTCTTGGCGATGTACCACTGCAGCAACGCAGTCTCCGACGACACCATACTGGTGGTGGCTGTGAAAGATTGGTTGT
GAGAGGTCTCCAACCGGACATGACATTCCTAAGAAAACCAGATTCCTAAGACTGTCTTGATAACAATTCCTGGTTCGTGCTCGATGCTGCACTTTTCATG
AACGTCAACCGAGAACGGACCAAGAATTGCAGGTTTCGAAATCTCTCTAATGAGTGCAATTAGCCATTGTGTGTGACCACAACACTCTGCTTAGAGCGAC
CGAATTCAAGCCATAAGACTACCCACTCCGGTGGCTCAGCACACTCTACCACGACGAGAATGATAAGTGACTGCCGCCAAGTCCAAGTTGCGCGCTCAAA
TTCGATTGCCAATTCGAACTTGGGACAAATTGGCACTAAAATAATAGATAAAGGTAGGCGAAGCGAAGAGAGGTAACCTAGAGCAACTTCTGACTTGCCG
CCGGCACGCGCCAGCGCGTGTCAAGTTGGAAGCCAACCACTTTCCATCCTTCCCATCGAGGCAGCACCCGCATGCTACCGGTACTGGTGTGGATTAACCT
CAATAAGCCAAATTTGTCGCTGTTGCGAGCCTTGTCACGACAGGTATTTGCTATCGATCCGACCGGTTGGCATCAAATAGCTCGCACTTGCTGTTCTGTA
AGGCAGAACTGTTGCGACGCAATACCTTTGAGTTTGTATACTCGTTTTGTGCAATATGATAGGTTAAAAGGCAATCAAATAGTCTATTTGATTGGATAAA
TGTCAATAAGGGAAATGGCTGAAGGAAAGAGGCCAGCGTCCACCCAACTTAAGGTAAGCCGAGGGATGTGGTGGAGAGGTGGTCATGTGATGCCACCTCA
TAT