Description :
From Genome Similarity Track
Location :
Scaffold_6:2648983- 2651358
Sequence
2375 bases(100 bases per row)
TGAGATGTAAAACGTTTCCTTGGAGGTAATTTTCATCTTCTTCTGGACTGAGAAGAACGCTCGGTCATACCAAACGAAGCGGATAATGCACGTTCACCAC
AACATGGTGTAATTAAACACAACCTTCAAGTAATCACTTATCTTTGCTCTCAATGCGGCAGCTTGATCAAATCGATCTGTCATTGTCTGTAGAATACACA
TATAAGCTCTACACATCAGACCAAGATCTACGTATGGGTTCTTGTATAGCATACCCGCCCAGTTCCAAGTATTATTGTTGTCATTAAACCATGACCACTT
CATCAAACAACACAGGTCGTATAGGCGATGATCGTAGATCTTTTTTAAACACAGTATTGAGCAACATTCAGCTCTTCAATCATGATTGGTACATTGAAGT
TTACAGCGGACGACACTTCAGCTGGTGGTTGCAGAACGGACGACATTTCAGTAGTCATGCATGTTGCTAGTACATAAGATTAACAAGTTCACTTCTACAT
TTTGTTTGAAGGTGACAAACAACAAATAATTCTTTAGATGGGAGTCGTTCCAGCATGGAGAAGCCCGACGAAGCGATCGTGCCTAAGCTGAAGAGGCAGA
TACCGGTTGCCACGTATCCCCCGCTGCTCCCGTTCACGGATCAAGACCTGATGCTGGCTCAAGAAACGATGACGCGTACTGTCGCGATCGAAGGCAGCGA
GACCAGTCGCCAGGTCGAAGCTTTGGCTCAGCAATCCGCAGCTGCACAGCAGATGACGGCTGCCCAACTCGTCCACGGGTATCACCAGCAAGAGCAGCTG
GCGGCAAAGACGTCGAAATAGCTGCAGGCACAACAGAACCGTCGGTCTGCACTGCTAGACAGCAACAGGAAATGAAAAAAAAAAACGGATGAGCACCGGC
ACAACCTGGAGGAGCAGTATCGACTGCTAAAGGCTGCTGAAGAGGCCAGGGGACTGCAGGGTGAGCGGCTTAATAGCCTCGCAGAGGCGGTGCAGCTGCT
CTTGCAAGCGCGATGGGGAGCTTGTGCTCAAGGTGCATCACCACCGAGCGACCAACGAACTCCAGAGCCACCCGCTGTCGCCGTGGCGCAGATACGAACT
TGCCTGACCCGCCTATTTACCGAGGCAGAACAAAAAATGTGAGGCGTGTCTATATGGACAGCTACGCTTTTTACTCACGACGTCTTATGGCGTTAAATCA
AGATACTCAAGCAAAGATTTTGTCATGCCGTTAAATACATGCATTGAACAGGGCACGATGGTGAGGATCTGCGGCTTTGAGCTGTTTAACCTTCATTTCC
CATAGAGCCCACGCGTGTGCTTCTGCGCCCACGGGTGGGCTTACTTCTACAAATGGACCATTGTCCTCAGCAAAGTTTACAAAGTCAGTTGAGAAGTTAA
TAATAAAACAACAACGACGAGGAGCTCAGCGCATTTTTTTCGACGTCATACGAAGCTTTCATCATGCCGAAACACGCTGTGGGAGATCGAGTACGCGAAT
AGACCAAATCGGCCGATCGTTTGCGAGGTGTGGTCCTATCGATAGACAGCAGCAAGCGACAGTCTTGGTACGATGTTCAATGGGATGCCGGCAGAGTTGA
AATGGTTGCAGCCCGCTCAATTCAGGCCTTGCGACCCTGCAACGCTCCAACACAGCCACACCAGGCACTTGAAGGACCTATAACGTCACTTTTACTGGGC
AGCGTGGGGGATGAAGAAGATAGTAGCCCATCATCTTCTGATTTTGAAGAATCGGAAGAAAAAAAATAAAGACTGCACCGATTTTAATTATACTTCGGCA
GCCTCCGAAGTAGCAGCGCCTGGAATATCGGATGATGGAAAAGTACTCGCATATAACCGGAGTTGGGAATTCTGCTCAAACGTTTTGATAGATTCGGCCG
TATTACTACGCAAGCGAACGACTTCCGTTGGCCATCAGCCCTTCAATCAGGTGAAAAACATTTATCAAATACTTCTATTTAATGTATCCGTGATCGGCAA
TTCAGAGTATGATCAAGCACACGAACGCTAAGCTGGCGGCCCGTCGTCAACGTACAATACCAGAAGGGGAATTGTTTCGGTTTCTTCTAGTCCGACTCGC
TATGGCAGTAGAACCTAGACGAGCTGCTCTACGAACCTACTGGGAAAAATACATTCCTGAGGGTTTTGTTGGAGCCTCTCCCAATTTTGGGGAACGTTTT
GGTGTATCACGTCACACATTTGAAGTGCATTGTCGTTTGCAGATGACGTGATGTCGGATGACCCATGGAAGCCAATGCGTGCTTCTTGCTAACAGCTTTA
ATGATCGCCGACGTGGAGTAGTTTCGCCAGGTGAGATCATGTGCATTGACGAATGTATGAGGGCATGGCAAGGTA