Description :
From Genome Similarity Track
Location :
Scaffold_709:2648- 4461
Transcript NameFunction/comments
Pytar_ATCC12531snap-par_contig_709-abinit-gene-0.23ATP-dependent RNA helicase DHX8

Sequence
1813 bases(100 bases per row)
AAGCTATTGCCGAGAATCAGGTGCTGGTCGTGATTGGCGAGACCGGTTCCGGTAAGACCACACAGATGACCCAGTACATGGCGGAGATGGGCATCACGTC
CAAGGGAATAATTGGCTGTACGCAGCCGCGTCGTGTCGCAGCGTCGTCCGTGGCCAAGCGTGTCGCGGAAGAGTTTGGTTGTGAACTGGGTCAAGAGGTC
GGGTACGCGATGCGGTTCGAGGACTGCACGTCGCCCGAGACCGTGATTAAGTACATGACCGAGGGCATGCTCTTGCGAGAATACCTCGCCGACAACCGGC
TCTCCAAGTACTCAGCATTGATGCTCGATGAAGCCCACGAACGCACGATCAACACGGACGTACTCTTTGGTCTGCTCAAGGAACTGGTCAAGAAACGCAA
AGATCTCAAGCTCATTGTGACGTCGGCGACGCTCGATGCCGAGAAGTTTAGCAGCTACTTCTTTGACTGTCCGATCTTTACGATTCCGGGACGTACGTTT
CCCGTCGAGATTCTGTACACTAAGGAGCCCGAACTCGACTACCTCGACGCGGCGCTCTTATGTGTGATGCAAATCCATCTCACCGAACCGGAGGGCGACA
TTTTACTCTTTCTCACGGGCCAAGAAGAGATCGACACGGCGTGCGAAGTACTGTACCAACGAATCAAGACTTTACAAGAACGCGCGCTCGCCCCCGAGCT
CATTATTCTTCCAGTGTATGGTGCGTTACCGTCCGAGATGCAGTCGCGGATTTTCGAACCCGCACCAAAGGGGTCCCGCAAGTGTGTCGTCGCTACCAAC
ATTGCCGAGGCCTCGCTCACGATCGACGGCATCTACTACGTTGTGGATCCGGGCTTTTGCAAGCAAAAGGCGTTCAACCCGAAGGTCGGCATGGACTCGC
TCGTCGTGACGCCATGTTCGCAGGCGTCGGCACGGCAGCGCGCCGGTCGCGCTGGACGAACGGGTCCGGGCAAGTGCTATCGACTGTACACAGAGAATGC
CTACAAGAACGAAATGATGTCGACAACGATTCCGGAAATCCAGCGCGCGAATCTGAGCTCGACCGTGCTGCAGCTAAAAGCTATGGGCATCAACGATCTG
CTGCGGTTTGACTTTATGGATCCGCCACCACAACAGTCGATGATCCTCGCACTCGAGAGCCTGTACGGGTTGGGCGCGCTGGATGATGAAGGGCTCCTTA
CTCGCCTGGGCAAGAAGATGGCGGAGTTCCCGGTCGAACCGAAGAACGCCAAAGTTCTGCTCACGTCGGTCGTGCTCGGGTGTGCCGAAGAAGTGCTCAC
GATCGTCGCGATGCTGTCGGTCGAGACCGTGTTCTTCCGTCCCAAGGAAAAGCAGGCCCAAGCCGACCAGAAGAAGGCCAAGTTCCATCAACCTGAGGGC
GACCACCTCACGTTGCTTGCGGTCTACGAAGCCTGGAAGAACTCCAAGTTCTCTAATCCGTGGTGTTTTGAGAACTTCATCCAGGCTCGCGCGATTCGAC
GCGCGCAGGACGTCCGCAAGCAGCTGCTGTCGATTCTGGATCGCTACAAGATGGACGTGACGTCGTGTGGGCGGAATCTGAACAAGGTGCGTCGCGCGAT
CGTCGCTGGGTACTTTGCCAACACGGCCAAGAAAGATCCGCAGGAAGGCTACCGCACCATGGTCGAAGGCCAGCCCGTGTACATTCACCCGTCCAGCGCT
GTGTTCAACAAGAACCCCGAATGGGTCTTGTACCACGAACTCGTGCTCACGACGAAAGAGTACATGCGCAGCGTCATGACGATCGAAGCCAAGTGGCTCG
TGGAGCTTGCGCC