Description :
From Genome Similarity Track
Location :
contig_54:264798- 265813
Transcript NameFunction/comments
g11287.t1hypothetical protein

Sequence
1015 bases(100 bases per row)
ACACTCCTGGCCAAATTAATACGGCCACCCACCGATTGACTGTAGCTCAGCCAATTCTACAGATATGGCGCTGCGGTTTGATATGTGTTTGTATAGTACA
GAGAAGCACCGTGTTTGTATTAACAACTGCGATTTTGCGGTTTTGGGGTAGCTCCCATACAATACACCGTTTGGGCATGCGGTCCAAATTTCCGGCCACC
CGAGCCCATACTAAAATGAAGATATATGTAACGAAAAGATTGTATTAGTAATACGTTTACCACCCTTCTTCTCAATCACTTCAATGCAGCGTCGAGGCAT
TGAATCTATGAGATAGCTTGATCAATGTTTTTCCACGCCGCCAATATAGCTGCTGTCAAGTCTCCAAACATTAGTGTACTGGCGTCCGTTGGGGTAGACT
TTGCGAGCCAGCAACGCCCCACAGATTCTCGATGGGTTCAGGTCAGGTGAACGGGAGGCCAATCGAGCACGTTCGCTCCTTGCTCTTCAAAGAACGCCTT
GGTCTTCTGCGACGTGTGAATGGAGGCGTTGTCTTGTTGATAGACAAAGTCCATCCCGTAGTTTAGGTGAGCATAGGGTAGCAAGAACTCCGATACAGTT
AGATGTACTGTGCCGAAGTCTGCCTCCCTATCAGCACCGCGAGCTCCGTCTTGCCCTTGGCGCTGAAGCCGCCCCACACCATCACAGAGCTCCACCGTTC
TGACGCCTCATTTGTTCTTGCGGTCGCCTCACGTCGTACCAGTAGCGTTGGAGGCCGTTGGGTCCGTCCAAGTTGAACTTCTTTCCATCTGAAAAGGTGA
TGCGCTGCCAGTCCTTCTCGACGTAACAACCATGTGTTTAGCCCACTCGAGACGACGGCCTTGTGCGCGGCTGTCAGCCAGCGTGTTCTCCATCTTGGTG
CAGATTAGCCAGTCTACACAAGCAAGGAACGCCGTATCGTGCGGGGTGAACACTTGCAGCTGCACTCCTCTTTCAGCTGCGCGGCCGTGTAATCGCCGCT
GGCCGCCTTGCGAAA