Description :
From Genome Similarity Track
Location :
Scaffold_6:2647411- 2648842
Sequence
1431 bases(100 bases per row)
GGAGATCGGCCGATGGTTGGCGAAGGACGGTATTCCTAGGCGACCTGGATATGTGTCAGTGGAGCGATCGGTTTCGCGTCGCCACTCTTGCCATTGTGGC
AAATTATGGAATGAGACACCGCTGCTTCGAGTCGGCAGCCTCGACCACTCATCCAAGTGTCCGGACTGACCAGATTACTGCAGCACATCTACCCCTTCCC
CCACCCTTTCTTTGGCATTTCCTTTTTGACCTCTTCTAGCTTATATTTTTTGGCAGCAAAAAAAAATTGATTTAAGTATCGTATCGAGCCATTTTCTATC
TTGGAATCCCAGTAACGTCGTAACTTACGACTTGTGCCCTCCTTGAAGTCGTAAGTTGCGATGTTGGTAACGGAGGAATTCAATAACTCATATGATTACG
CAGAAGAGATCTTAGAAGCGGAAAACGAGTTCTTCTTTGAGCAGTACATCGAAACGGGCAAAGTAAAACAGTTTAATGTAAAGAAAATCCTTAGACCGCA
TGGATGCTATTGGAGCGTTTAGCGAATACGTTGCCAGCAAGAACCCGGGTATTAAAGGACCGAAAATGATTAACAGCAATGCGTACTTCGGTTGATATCG
CTATTGCTTTTACATTCAAAAAGGCAACAAACTGCTAGAACAACTATATTGTAAGAACGAACAGATGATGGTCAGCATCTGTGCGTCTGTCAATCCGGCA
GCGTTAACCCCACCCTGCCGGGCGTTGCTCTTGTGCTAAAGCAAGTGCTGTTACCGCTGAGCTGAAACCTCAGCGGTTGCTGCACTTTGTAGCATTAGTG
ACAACGGCCCCCCCCTGGTTCATATGTATTTATGGTTTATCTATCCCAATAGATACTAGCATCGTTTTTATATTAGCTTGAGATTTGTCGCTTCTTAAGC
AATCTTGGAGTCCATGAAATCACACATGGAATTGAACAGCTTTTCGGTGTGGTCTTTTCTGATTTTGCTCCATGATTGCTTTGTATGTTATATCAAATAA
ATTATTCCTCAAAGATGTCAATCTCAAGCGTCTTGTCGCTGCCAATAGATGTGAAAGCACCATGGAATATCCGCCCCCAACGGTCTTTAGGTCTGCTTAG
CGGAGCTGTAGCGGGCTTTGCAGGAGGATTGGATGCGTGATCGGATGAATGGTCTGGCTCAAATGAAACTCCGGAAGCATCGCTCGGTTTGCAATCTTGT
TGTAGCTCGTGTTAGCAGCCATGGTGCTGTGCAGTAGTTTAGCGTGTAAATCGTTCATCTCGCGATTGACAAGTTCAGCATAAGCTGGCGATTGGAACAA
ATGAGACTTAGCAATGTGCCGGATCATATTCATTGACATTGGATTTCCATTGTACTTTATGAAGAGCTTTGACAGAACTTGACTAAAGCTATTGGTTAAA
TTTGTATAATCAGACTCGCCTGGTTGCTGAT