Description :
From Genome Similarity Track
Location :
Scaffold_150:26472- 29563
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_150-snap-gene-0.28Conserved gene of unknown function
Pytul_var.sporangiiferumsnap_masked-pug3_contig_150-abinit-gene-0.44Calmodulin binding protein

Sequence
3091 bases(100 bases per row)
TCCTGTAGGCAAAGCTCGTCAGGAGGATTTTGGAACCCGAGTTGTATGAATTCAATACCAATGAGCCGCTTGCACGCACAGGTGAATCCTTTGACATTTG
CCACTGCGTTGAGCAGTTGGACGCTATCGCGAAGACTCGTGCGGGAATCGATGACATTCGCGTACAAAAACGTTTTCGCATTCGCGGTGAGCAACGGTAG
TATGAAATTCGACAGCATCATATTTCTCGTCTTGTACAGCGATGCATTCGCCGTTCCATTTCTTCCAGGCTTCATCTGTGGCAACGCCATGACGGTATGA
TGTCGTGGTGACGCTGGCGGCTGTCGAATCTCGTGCAAAATTTCCAAAAGCTCTTGTTTCTCATTGATCGAAACGCTATCATTTTTGAAGTCCTTCAAAT
CAATCAAGTCCACAAAATGCATTGTACTCACTTGGCCGTTGTGAAAAAACGCTAGGCGTAAGAAGAAGTGCGCATGTTCGGCGTGCTGCTTCATCACGAT
GCGGTTCGTTTTCGCGATCTGGAGGATTTTGCACGCGCTCGCAAAGGATTTCGCTTCGAGAGACACAAACGACAGCGGAGCTGGTTGCTGTTCAGAGGGC
GAAGATGATGATTGCTCAGCTTTCCGTGACGATGTCGATGGTGACACGACTGGCTTCAAGAGGTCAATCGCCTGGTTGTTGACGACGATCCAGCCGCTGA
TCCCGAGACGCCAGCCGGAACTTGCCAGCGAGGGCTGGTGAGCACGAATCGTCGACGACATCCTTCGCGGTGACGTGACGTGGAAAAACTCGCACAACAG
CGCTCCTAATTGGCCGTAGACCTCTAAAACTTCTCTGTCCACAGCAGCAGAAGGCGACGACGATAGTTGCCCACTTCCGGGGAGAAAATCATTGCCGNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCGTGCTTTTCCCAAAGAGCAAGCGAAACTTTTGCGTTGGATGCACGCCCCAGGCCACGACGTTGG
TNNNNNNNNNNCCAGCCGTCGCAGACATTGCGGAACGCTGGTTGCGTGATCTCCCGGTAGAAATCGCTAGCGTGGGACGACGAAGCCGACGGGAACAGCA
TGTGGAAGTCCCATTCAGCGCTTGGCACGGCTGTGTGGGACGAGGACCAGCTCCCGTTGGAATTGGTGCTTCCTGAGTTCTCAGGTGCTGCGTTCGTGGA
CGCGGCGGTATTGGACGCCGTGTCTCCCAATGGCTTGTTCACGACGCGCACGCAATGGCGCTCAGGCACAACTTCGAACACAGGCGTGGNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNATGAAGCACGACACATGCACCTGGCTCAAGACGATCGGATGGGGACTCTTGAGACTCATTGAGGCTGTCTCGAG
TCTGCTCATCTCTGCCCAGTTGCGTTTCCCCCTGTTCATGAAGAAGCCAAAGTGTAAGTGAGCCTCGAGACATAGAAGGCGCTTCAGATCCATCCACATC
CACTACACGCATGCATCATACCTTCTTGCGTCGAGCATGAATGAGGCTGCATCGAGTCGACGGGTAAATTTAACTTAGCAAATATATAATCGTATACAAT
AAGAAAAAAACGCCCTTCCTACACATCATAAACTAACTTTGGTCTCTGAAACGCTGCAAGAAAAAGGAACGAGAGCTCTCTCATTGCTTCTTCTCTTTTA
CTAAATACCATTACAAGAGATCTACCGATCTCACTAGAGTACACACTATAGCCGCTTCTTCGTCTTCCTCCTCCCGTGGCTCCTCTTTCCTTGATAAATT
GATGTCGATGTGCTGCCTGCTTCCTCTTCTTCTCTATTCTTGCATTTCACAAGTCGCTAGTAGCTCGATGGGGTTGTCGAATGCCGAGTCGCACGTGCTG
GAATGACTGATCGTAGATCCATCAAGGTCCATGCCTTCAAACTCGAAATCGGTAGACGCCACCACATCGTTCGCATCCACCATGTTGCGATCTTCAGCTG
CGTCTGGTTCGTTAAAGTCGCAAACACCGCCGGCCGTCTTCACAGCTATTTCCACGAGATCATCGAACAGCCCATTCTTCCACGACGAATGCTTGTGTTC
CAAATAGTTGAGAACTCGATAGGCCTTCCAAAAATGAGCATTATCTAGCTTCCGAATAAGTGCACCGTTCACCGTCGCGCGATACACTTTCTGGATACGC
TGAACATCTACCTCAACGCCACGCAAGTCGACACCATTGGCAACCAAAAACTGGAGCAGCACCAGCAACTCATGCTCCGATGGACGATAATGACCGGAAT
GGGGATAAATAGTCTTGATGATCCCATCGACGATCACCATCATGCCAGCGGTCTGCACACATTCTCCTCCCACAAAACTCGTATGATGAATCCGCGGGAT
TTTCTTCGTCTCCTTCTGCCCTCCATACAATACTCCGTCACGCAGCACAAAAATCCAGCCTTCTTCTCCAGTTTCCACGATCTCTTGGGTAGCATCGCGA
ACGATGATTCCGTTTTGCACAGACAACGCAAACTTCTGTCTCTCAGCTACAGTGTCGCAGTACAGGACGGTTTCTCGCTCCAGCTTTGTCCGAGGAATTC
CTTCCACTTCGACAGACTCGTCATCCAGCCATTCCCAGAAACTTGGCTTGGCTGCTTGGCGCTTCCATTCCTTGTAGTACGCTCTCAGATTTGCACCATA
GCTGTAAAGGCACAAAACAACTCCGTAAGTTCAAATCATGTGATAATGACCAAGTTGCCTTCAACAATGCAAACCACGTACCGATGCTTGCGATCACAAA
CCTCTAACCAGCTCTTTTTGTCAACGACCGAGATGTTGCCTGCGCTGTATCCCTTCACAAGCTTGGGCGAATATTTCTTCGCGAGCTTGACGATTTCGTG
CATGTTCTGATACGTGGTTCTTCGTTGAGAACGCATTGTCTCCGCTGTCATTTCGTGGTGGACCTTGGGGTGAAGATGTCTTGAGTTAGCCAATCCCGCA
AAGCACTTGAACGTCGCACAATCGAACAATGGCCTTCGTCGTCACTTTAGTGTGCAGTCGTTCGGTAGTTCGGGGAAACTACGTACTAAAC