Description :
From Genome Similarity Track
Location :
Scaffold_149:26465- 30133
Transcript NameFunction/comments
Physo_143715hypothetical protein

Sequence
3668 bases(100 bases per row)
CTTTTTATCCTTGTCGGCAGCTCCACTCCGCAGCACATCCATGATCATAGCCACGTCGGCGCTTTTCGCAACCTCCTCCTTACGCTGCTCTGCCTCCTCC
TCAGTGAGCTGAGCAGCCTTGCGCTTCTTGGACTTCTTTTCCTTCTTGTGCTTCTTGTGCTTCTTGGTGCCCTCTTCAGTCGCTTCGTCACCCTCCACGA
CATCCTTGAACAGGTCGGCGATCTTCTGCTGCTTCGTGTACAGGGCCTCCCACTTCTCGCGGCTCTGCTTGTACTCGAACAGGTGGCACGTGTTCATCAC
AAGCTGCGAAAAGTGACTGCCGCTGAGCTGGTTCTCAACTGCAAGCAGTTCGTGCACAACCGCCTCCTTCTTGTCCAGAGGCAGATCCTCGTAGCACTTC
ATGACCGAGAAAGCTCCAAGACGATCCATCGCCAACGTGCCGAACTTGCCCACAAACCGCTCGTACAGCTCTTGCCGCACCCAGGCGGTGCTCGGTTCCT
TGGACTCCCAAATGGGTTCCACAATGCAGCGACTGCCGGTGGAATCCTTCGCCAGAGCCATGAGCTGCGCCGAGTTGAACGAGAGAATGCCCTTGTACAA
AGGCGTCAAATACTCGCCAGCCTCGAACTGCTGCATCTGCTCGATGATCTTGGCCCCCATGACGTTCAACTGCACCTTAGCAGAGGTCGCAGAGGTCGAC
AGCTGCACGTTGAGCAATGACGCCACAAAGTTCTTGCGGACAGCCTCGGGCTTCTTGCTCTCTTGCTTCGCCACGGCATTCACGAGGGCTTCAAGGACCC
CCTGCTGGTGCAGCTTGAACTTGACGCACATCTCCACCACGCGCCAAATAACGCCGGGTCTGCCCATGGTCAAAAGCGTCCACAGCGACGCCTCCAGCTC
CTCCAGAACCTCCAGAGCCAGCGCCTCCGTACGCACAAGCTTGATCGCGTGCTGAACGACGTAGTTGGCAATGTTGTGCTCTACCAGCTGCAGCATTTTG
CCGCGCACGCAGCGCTCGAACACCTTGGTGAAGAACTTGTCACTGGCGCTCTCGAACAGTCCCTCCAGCAAGTGGCTGGTCACCGCGTCGGCCGCCAAGT
CGAAGAACCCGCTCTCGCACGCGGCTTCATCCTCCCACTGGAGGATCTTCTCCGCCAGTTTCCGTCGGCTCTTAGATGGCGCCAACTTCAACGCCGAGGC
GATCAGCGGGCCCGAGTTCTGGTCGTACAGCAGGTTCTGCAGCTCGTGCGTCGGGCTCTCGATCAGCACCGACAGCAGCTCCTTGAACAGCTTCTCGAAG
GTGTCCGGCACGTCGTAGCTCACTTCGCTGCCGTCCTTACCGGGCCGCGCCTCCGTGAACGTCACCATGCGGTGCTTGGCCTTCTTGCCGCGCTTCTCGG
GCACCAGGGGCTTGCCCGCCAGCACCGCCAGCACCGAGCGCAGCACGTGGCTGGCGCTCACGTCGTTCATGAGCGTGATCCACTCGCCCTCCACCTCCTT
GACCATGTTAATAATAACGTCACTCATGGGCGGAATGTCCTTCATGCGGTCCTCGTCGTCATCTTCCTCGTCCTGCTTGTCCTTGTCCTCCTCTCCGTCC
ACCTCCTTGGCCACCACGACACTGGCGAGCGACAGCAAGTGCTGCAGCACGTGCGACGAGTAGCGGTTGGTCCACAGGTGGCTCACGTAGCCCGCCATCT
TGTGCAGCAGGAAGCGCAGCTGCGCGTCGCTCATCTTGGGCAGGAACACCTCGAGCAGCTCGCCCGCGTGGCGGTCGGACGCGGCGCTGGCTGCGCGCGG
CGCCAGCTCCTCCAGCACGTTCCACAGCATCATCTGCGCGTCCTCGGGCGTGGAGTCCTCGCCAGGCTGCGTCAGCATCTCCGTCACCTCCTTAAGGTAG
GACAGCGTGTCGGGCTCCAGGCGGCGCGGGCGCAGGCGTCTGCATTGCAATAAGGAGGCAAACGTGGTTAGCAGGTATTAGAGGGCGAAGAGGAGGGCAG
TAGGTGGGTGGATGGGTGCGTACTCGGGGCGCTGCTGGCGCGCGTCATGCTCCTCGTGCTCGGCCATGGTCAAGGGGTCGTCGAGTATACGACCGTTGAT
ACACAAGTGAAGTGCTGTTGGTCTGCTTGTCAGCCAGCCAAAAAACATTAGAGAAAGGTGGTGTGGGCCACATTATGTGACGAGGTTGCGAGTCGTACTT
AGATGAGGGCTACTTCAACGTGATGGCAACAACTCGCGCGCTCAGCGCCTCCTCCAGGATAGCTAGATATGTGCCAAGGAGGTAGGCTCTTCCAGACTAC
CCTCCGATTTGTATAAGAGAGAGCAAAACTACCAGGTGAAGGTCATCTCAGGCCAAATTCATAAGTCTGTAGGACACCTCGGCCTGCTAGAGATTGGCAA
CGTCGCGCTGGCTGTCGCCATGATGGCGCCACATAATGCGCGATATGTACACGTTCCACCGTTTTGACGCACTGAGGTTCATTCGCGCGCTGCGCGTGTT
TCTCTCAGCTCACTTCAGCACGTCGATCGCTTGTCGATGACAAGTTCTGCATGAAGAATAACAGGTTGCTGTGTACGTATGCGTCCTACTTGCTGTATGA
CAGTTTTACACGCCGTACGTTTGGTACGAGAGTTCATGCAATAGAGCCTGAAGATGCGCTCTATAGCACGAAGAGTGCTGGCACAAACATCTTTGAACAT
TAGATTCGTTCTACTGCGTAACTTTCTCCTATCATCGTGCAACACCGCTCTCTCCTGTCTAACTAGGCTAACGTTGAATGACACACGTAATGGTAGGAGT
ATGAAATACTTGTTGCGATTGATCAGGGTTAAAAAGCTCTAGATTTCAATCTACACATAGGCTTCAGAGTTGGATTATCTTGTAAACATCATTTCAATCG
CGATGCAAGAAGCTGTTCGGATCCGCAATAAGGTCAGTGCAAGGATGACTATGTTTCTCTACACCTTGAGAGCCACAACAGCCCTTCAGAGAGATTCCCA
TTATGTCAAGTTCATCACTCCTTGTCGCTTGGTCCGGCTCGCCACAATACACAAATACAAAATCTACTGGTGTTGAGAATCAGATAGGAGCGAAAGACTT
TGATGGAATGTTATCAACAGAAGCCTTGGGGGCTGTTCAGTTGAACTATGCATATTTGAATCATCACCTCCTCAACAACATTCATACACACACACATATA
CACACACGTACCACGAAGATCGCGATCGGCAAGCTCAGTTGGAAGGCAGCAGAAAGTGATTTTGTTTTCAGCAGCAACACGATGATCGCCTCAAACAAAC
ACAGATATCCTTTCTTTCATCCTCGCTCACACGCAGATAGATATAAACACGCACAGCCATACAAATTGAAGCACGGACTCAGGCAGTATGAATACAACAG
CCGTCCACACGAGCTAAAGCATCTCGGAAGGTGTCCTAAGTTTGAGTGTCATCCTCATCCGCGCGCACGACTCGCGCAATATACAGACATACAGATATAC
AGACATACAACTGGCAGTGGATCGATCAAACTAGCACCAACGTCCTGGCAAAAGAACGTCGGGTCTTTCGGTTGTACTCAGCGTCGGTCGTATGGGGAAA
GAAGTTTGTCCTATCATCTCGATCCGGGGGGGAAACAACGTCCTGTATCCATCGGTCTGGAGAAGCTG