Description :
From Genome Similarity Track
Location :
contig_54:264618- 265633
Sequence
1015 bases(100 bases per row)
ACACTCCTGGCCAAATTAATACGGCCACCCACCGATTGACTGTAGCTCAGCCAATTCTACAGATATGGCGCTGCGGTTTGATATGTGTTTGTATAGTACA
GAGAAGCACCGTGTTTGTATTAACAACTGCGATTTTGCGGTTTTGGGGTAGCTCCCATACAATACACCGTTTGGGCATGCGGTCCAAATTTCCGGCCACC
CGAGCCCATACTAAAATGAAGATATATGTAACGAAAAGATTGTATTAGTAATACGTTTACCACCCTTCTTCTCAATCACTTCAATGCAGCGTCGAGGCAT
TGAATCTATGAGATAGCTTGATCAATGTTTTTCCACGCCGCCAATATAGCTGCTGTCAAGTCTCCAAACATTAGTGTACTGGCGTCCGTTGGGGTAGACT
TTGCGAGCCAGCAACGCCCCACAGATTCTCGATGGGTTCAGGTCAGGTGAACGGGAGGCCAATCGAGCACGTTCGCTCCTTGCTCTTCAAAGAACGCCTT
GGTCTTCTGCGACGTGTGAATGGAGGCGTTGTCTTGTTGATAGACAAAGTCCATCCCGTAGTTTAGGTGAGCATAGGGTAGCAAGAACTCCGATACAGTT
AGATGTACTGTGCCGAAGTCTGCCTCCCTATCAGCACCGCGAGCTCCGTCTTGCCCTTGGCGCTGAAGCCGCCCCACACCATCACAGAGCTCCACCGTTC
TGACGCCTCATTTGTTCTTGCGGTCGCCTCACGTCGTACCAGTAGCGTTGGAGGCCGTTGGGTCCGTCCAAGTTGAACTTCTTTCCATCTGAAAAGGTGA
TGCGCTGCCAGTCCTTCTCGACGTAACAACCATGTGTTTAGCCCACTCGAGACGACGGCCTTGTGCGCGGCTGTCAGCCAGCGTGTTCTCCATCTTGGTG
CAGATTAGCCAGTCTACACAAGCAAGGAACGCCGTATCGTGCGGGGTGAACACTTGCAGCTGCACTCCTCTTTCAGCTGCGCGGCCGTGTAATCGCCGCT
GGCCGCCTTGCGAAA