Description :
From Genome Similarity Track
Location :
Scaffold_1003:2646- 4068
Transcript NameFunction/comments
Phymu_g12541hypothetical protein

Sequence
1422 bases(100 bases per row)
ATGTTCCATACAAAAATGCAGTCAAACCTAATGTTGAAGTTCATCTTGAAGCACCTTGTCAATACTTGGTGTGGCCCCCAATGCTGTCACGcacagcttg
aagacgcttaGGCATAGACAACACCGCATTGGCCACTACGCCGTCGTCAATGTTGGCCCACATGCTGCCCAGTTCCACTTTCAGGTCCTCGATCGAGGTC
GCTGGGGATTTGTTCAGTTCTCGCTTCATGATATACCAAATATTTTCAATCGGGTTCAAGTCCGGGCTCTGTGGAGGGTGTCCTAGGGAAATTAAACGTA
GCTCACGAAGACAGCTACCTGTCATTTTGGCTCGATGCGCCGGTGCATTGTCTTGAACAAACAGAGTCTCTCCCTTTAGCCCTAGAAATTGCTTCGTCAG
TGGAATATCATGGCGGAGTAGCCGTCGATAGTAGTCCCCCGTTACAGATTCGTTGCAGAAGTGCAAAAGCCCCACGCCATTCGCAGTGATAGAGCTCCAG
ACCATAAGGGACTTCCGGCTTGATTTAAACGTAGGAACCACGCACTTTGCATCGAAAGCCTCATGCGACCGTCTCCAAACCGAAACCCGACCCGACGTGC
CGTGCAACTCCACACAAGCCTCATCGCTGAACAAAACCCTCTTCCAGAAGAGGGGCGACATCGTGCCGAACTTCTTCGCGTAGGCCAGCCGAAGGCGGCG
ATGCTTGGGACTCAGGTACGGTTTTTTTCGGGCATAGCGTCCATGAAGCCCGGCTTCGCGAATACGATCTCGGACGAGATCTGTGGACACGGGTCTAACA
ATATCCTCTGACACTTGGACAGCAATCACTGCAGCACTGATGAAGCGGTTCTTCTCAACTTCTCTAATGATACGTCGGTCTTGACGAGAGTCGGTAAGGC
GAGGTCGGCCTGGGCACGGAATCAGCTTTGAGCGaccgtgcttcttcttgtaggCGATGATGGTGCGGACACTCCATCTTGGCATTACAAGATGCGAACT
AATTTTTCTTGTACTGCAGCCTTGCTTCCACTTGATAATAACCCGACTGCGGAGGTCTTCAGGGTACTGGCGCCTTCGAATTGGCGCCATTGCAGgcaaa
ttgagaagtgagagGCATGACACTGAGAAAGTTAGTTCTTCGGGTAACATTCGTGTAACATTCGGAAACTCAATACAAAAGCTAAGTATAAAACTTAACT
GCATTATAGCCATTGCCTCACGATTAGCAGCTGAGATTATTGGCGGAACCGTAGCGCAGTCAACCAATCAAATTAAACCGAGCCCTTTGGGAAAACGATC
CCCTGTTGTTTGCGCATCTAATGGCGTTTGTTTCGTTTCAATCGAGGCAATATTGAAGTCGCCATGATTGAAAATGTGCTTCAGTTTGGGGGTGGGCGCT
CATTTAATCCACCCGCTGTACA