Description :
From Genome Similarity Track
Location :
Scaffold_2446:2645- 3887
Transcript NameFunction/comments
Phyta_totarag14500hypothetical protein

Sequence
1242 bases(100 bases per row)
CTAACACTCCCAAGCTGTACACCAGTGCCTTATCCAGAGTGGAGGAAAGCACGAAGTATTCTTCTGCACTTGATTCGTGTAGAAACAACTCATCCGATGA
AGTTCGGTCCGTCGACGATAAACGACACCGACAAGTATTGCAAAATGGCATACGCCACTCTGAATGAACATCTTCGTTCAGAGTTCCCGACATCCTAAGC
TGATCTGTAACGCTATACATCACCTGGACGacaaaaggtgttcacccaCCTCGTCTCACTTCGCGCCGagctacttcgacgacgtgttcatTCACAGCCG
GGCTGTGAATGGGAAGACGGATGTTGATATGTACCTTGTGCATCTCCGTAAGCTATTTGAGCTGATGCGTAAGCATAAGCTCTATGCgaacctgaagaag
tgcaacTTCGGGGCGAGCGAGATACCCGTACTTGGGTGTCTCGCCGGGAAGAACGGCGCACGCCCTGACCCAGCGAAGGTCCGAGTGATCAATGAATGGC
CGGAACCATCCAACGTCAAGGAACTGAGGCAGTGCCATGGACTTGCCACGTACCTGTGCAAGTACGTGGAGAACTACGCGGGCAAGATTNTGATCGTGTG
GTCTTATACCAGTCGCGTCAGCTGAAGCCAGCTGAGCGTAACTACCCAGTACATGACAAGGAGCTCCTTGCCATGAAGTACGCACTCGCAAAGTTTCGAG
TGTATCTACTTGGGAATAGACCGTATATGGTCTATACCGACCATGCATCACTGCATACGGCGATCAAGTCGTCGCATATCTCCCAAAGAATGGCAAGATG
GTTTTCATTCTTTGCAGAGTACAACTTCCGGGTCGAGTACAAACTCGGAAGACTAAATGTAGTGGCCGACGAGCTATCGCGTCGACCTAACTATGCTGTC
AAGACAGCCGACGCCAATGCCATTGATGTCACTCGTTCGAGtactccgtcgtcgtctctgaTCGACGACGTAAAGGCCGCGTATGcgcacgacgcagacg
cNGTTGACGGACAGGAAACGACGGGGACGATCTGGGTGAAGAGATTCCGCAGAGTGATGATCCGAGACACGCTGACTGATTCTGATTCGGGTGACGGGCA
TGTCCTGTCTATGTAATCGATCGCGGAGACTCGTCTACGCACCCCGATCTAGGGACCCCGATCTAGATAATCAAGCTGAACGACTATGTCAACAGAGGTG
GGAAGCACGACAGACTAGGGATAGGTATATTATGGAAGGCTC