Description :
From Genome Similarity Track
Location :
Scaffold_15:264336- 284222
Transcript NameFunction/comments
Phypa_INRA-310PPTG_08071hypothetical protein
Phypa_INRA-310PPTG_08072hypothetical protein
Phypa_INRA-310PPTG_08073hypothetical protein
Phypa_INRA-310PPTG_08074sulfate Permease (SulP) family
Phypa_INRA-310PPTG_08075plasma-membrane proton-efflux P-type ATPase
Phypa_INRA-310PPTG_0807612-oxophytodienoate reductase

Sequence
19886 bases(100 bases per row)
AAATACCGACTTTCCAATCCCAGGACTTCCAAGCACACGAATTTTGCAAAGTGGCATAATTTGGTTCGGTCTTGTCTCTTATATGGTACATCATAACTGA
CCAATCACAACTATGGAATGCAAATTAGCGTCTTTCATTGGCCAAATGAACCAGCCCCTAATTGGCAAGCCCGGCCCCGAGTTCGCATTTCCCTTATGAG
AGAAATCATAATGACAACCCGTCTTACATTTGAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCAACCGGAAGGCGGTTAGTTGTCCGTGATAACTTCTATACCCGCCATGTTCTTGCTCGCGCCATT
CAAATTATGATTGATGGGGAAATACGGATGTTAGGCACTGTTCGCCTCAATCTTGTCGATGCCTGGAATAAACCGAGTCTTCGAGAAGCAATCAAACGTG
TCCAAGATGCTTATCGTGGTGTTTGGGAGCTGGTTGCAGCTATCGAACCGGTGCCAAATTGGAGAGAGCTCCAGGAAGAACACGGAAAGTCACAAAAAAA
CTAGGAAGAATAAACGGGCTGCGTTCAAAATGCCGCTTCAGTTTGCTCCATGCGCCGGTTACGTTGTCTTCAAAGACATGAAAGTGGTCATATTCTACAC
GAATGACTCGGCTGATACGCCAACGTTACGATTTCAGGGTCCCGACAATGAAGAAGCTATTCGCGTTCTGCATGGGCTAGAACCTTTGAACCGATGGATT
GGAAATGAAATGATGCACAGGAGTGTTCTAAAAGTACCCTCAGGTATCGTGGCATACAAAATATATATGAACAGTGTGGACCGTGTGGACCAAAAGTTGA
GCACCAACAGATCGCAACGAAAGGAAAAGCGGCTGTCCATGACAATGTTTACGTGCGCACTAGACTTATGCGTCTTGAATGCCTACGGGCTGTTCTGCTG
CCTTGAATGACGATGCGCGAGTTCAAGCGCAGGGTAGTGGAGGAGTTGACCTCTCGAGAGCGATCTCGACGTGAAAAGAAGAGGTCCGGTGAAATACCTG
CTGCAGTATCGTCGCCCCGGGTCATTGTCAATGTTACATCGGATCACCACATCACAACCAACAAGAGAGGGCGCGATCTAGAATGTCGCCTATGTCGGGA
ACTTGGTTTGCAAGTAAAGGTGCGCTATGGGTGCACCGGTTGCAAGGAGGGGTTTCACGTTGATTTCTTTACGGCATATTACGCCAGGGATGCACTAAAC
AAGGACGACCCAGACATGCTCAAAGTCCAGGAAACACTCGCTGAAAAATCTATCGGGCAACCAGTTCACAAGACCCGGGTGCGATCGAACAACTCCATCA
CACCGCTGCCCGAACTCAAGCTCCACTGCCACAGGCGCTCGGGCAGTGCGTGAGCCAACTGAAGCTGTAGGCATCTGAAGAGTAGTCCTGAATTGAATAA
AATGCCGGTGTCCATTGTTTGATGATAATCTTTTTTTCCACCTCACGGAATTCTCACCTCACATTACGTGAACGTACGGCCAGCCTCCTCAGCAGCAAAT
ACAGTCTCTCTACAGAGCTGTCGCCCCGTCCGACGCTGCATGTGGTGTACGTCCATGCCGAAATACTCGCAGATGTAGCGCGTAGTCGAGAGCTTGCCGA
GAGACTCCACCAACCGTGTGAGCACCACCGACTCCAGGTCACGAATGCTGCGCAGCGTCATCAGGTCCAGAAGCACGTCTGTACAAAGCACTTGATACTG
CGCTTGTCCTAGCTCACCAGCAGGCGAATGACGGCCTCCATGCCTCCACGACTCGTAGTCACTGTAGCCCAACACCACCGGATGTGCCGCCCATGCTTGA
AATACTTCCAAAAAATCAGCACGTAGCGGTTGATAGCGCTTGCTACTGTGGACGACGCGAAGATAATCTTGAGATGACGGATAGCAATCATGCGGATCGT
GACAGAGCTGGCGGCGCGCACAAGACCCAACAAGGCAGACATCATGTTGTCTTGCCAAACCGTCGCAGTTGTGAGCACGTTCTCGTCGATGAGAGCTTCG
TATACCCATCTAGCGTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGTGGGCAAGCACACGCCCGTGTGCATCCCTTTTCGGCAGTGGGCAAGGATACCCTGCTCAGTTAACG
CAAGTTTTCGCTTAAGTTAATGAAATATTTGTTTGCGTCGCCAAATCCTTTGTATTAGATGCATGGATCAAAATGGGAGGCTATTTTCATGCGTGCATCA
TTCCAACAGTAGGTATAAGTATCAAGACAAATACACACAAGTTTCCCTACTTCAGCAATGATAGTCTATAGTTTAATATTGAAACACGATTCAAGTTTAC
ACTTATAACATTGCTTTTGAAGTAGAGTTTGTGGAAGTGTTCAATAACAACAGAATTTGTATTGGGATGATTACTAAAGAAGGGACTCTGCGCTCAAAAT
GCCTAGCGAAGTAAGCACTGTATATCTGACGCAGGTGAAACATGAGGAAGCCGTCCTTGTTGAGACAGACACGGAAGTAGCTCCGTCGGAGATGGATCGG
TATACGTATGCGGATCAATCATATGTGTGACTGTAGGTAGATGGTCCATTGCGCTACTAGATGGACGTGCTCCCGTCACAGCCTGCCCTTGCATATCTGA
TACAGGGAATAAATAGCAGCTCCTCTTAGCAGATGCCGCTGCCTCTGCCTGTTGTGGGCCATTGCGAAGGATAAGGGAGGTATTAAAATCTTCGCAGGTG
TCCTGGCGTCGGCAATTATCGTAAGTATCGCTGATGGTGTCACAATGGAGGTCCATATCGAGCTCAATATCTGAGCGTGGGTTCAGTAAAATCGCTGGAG
GCAAAGCAGCTTATGGATATGACCTAAGCGTGCCTGCTGAGTCCGTCCAATACTGGAAAGGCGGCTTACTTCAGATTTACTTGATCGGCGGACGCGGCGA
TCCTTAAATCTGAGATGATAGCCATCGACACCAGGAACGCTGAGGACAGTAGCTGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCATGGGCACACGCCAGAAATTCTGGAATTAGGGACACTTGAACT
GATAGGTGTCGATGCGGACGGACCAACCCTGTTGTGGCATGCCAATGTGGTGCGTCGGACACTCTATTTTACAGCCGATCGTTAGAAAGTGAATGCTGAC
TTCTTTCTCTCATCCGATAAGCACTCCGGCGACCTTAGAATGCCACGATACACGCCAGCACTGACCTATTCGGGTATATGTCTGAAGCGTCTGCCGACAT
TGTAGATTACGTAAAAAGCACATGAGGTATTTACTATTCCTGAAGCCGAACAGCACGATAAGACCATTCAGTTGCATAATCTCTGCATCACTCAATACTG
CATTTATTCGTAGTTTTGTCCCCATATGCTCGTAAAATAGATTAAGGAAATTTCCAATTGCCCCGTAGTACTTGCGCTGCGTCCTTGACTCGCAATAACA
GGCTGACAAGTTGATAAGACCGGCGGCGATCCGTGAATCCACACGAGATGATAGTTCAGTGCTCCCACGGATCATTTGGAGCAATATGCTAGGAGCGCCA
GACATATCAGCACCTGCTCTTGAGTTTCCGTCGTGCGCGCATATTCATCGCAAGGTGCGATACAGCCGTTGGCTAGAAGGGCCTAAAGACACTTTAAAAC
GAGTACGACAGCTTGTCCGCGTCAAAGCAGTTTCGAGCGATTTAGATACTGAGACTGCTTTCGGGTTTGGAAATAGACAAACCGAAGATGGGTTTTGGTT
TGTGGGAAACGGGGAAGACGAAGAACCTTTGATACTGGGCATCGCCAGTGTCACACTAATGCAAATCCTATTGGTTCTCCAGGAAAAGCAGCCATTCTTG
TTTTTCTAGCTAGATACTACTTTTAAGCTCAGTGATATTGGTTATCCAGATATCATTTCTGTCGAGTTTTACAAATGCACCATATCCGAAGAAACGGACG
CGGGGCAAGTGGATTAACGGTAGGTACACTGATTACGACTTGCTTAATTAGGACTTGTTTATTGCTGCTAAAAAGACTAAAGAGGATGCTGCAGCTGAAG
CCAATTATTGAAGGAGGAGCGTACGACCGCAAGGCGTGTTGCGAACGCGAGGAAAGAAAAGAGAAGGGTCTGCGAGCGAAGACGAAGGAGTGCGCAAAAG
AAAGGTTCCAGAAGGCGAAGCAGAAAGTAGAATAGACAGTGGCAAGAGATGCACTAAAGCGGGGCGTTCCGCCATGAAAAAATTAAATTCACAGCCCAGT
TGGTCGATTTGTGGTTGTAGACATCACCACCAGGCGATATCTTCATGTCGGTCGTTGTCTGACCGTTGTATAGTGAGGTGCCGATATTTTCGTGATTTGG
GTACTCTATAGTAAACAAAAAAAAGACCCAACATATGTCTTAGTCTTGTAGTGACGTCTTACAAAAAACAATATATTTCAAAAGTGACCTGAAGTACGTC
TGGTAGGGATACGGAAAGGAGATGAAAATGAATATCTGGGTTTGCCCCTAACGACAGTAAATCTTCAAAACTGTAACTTTCGGCTTTGGTCCACGGATTC
ACAGCTACAATAAAGCACGCTTCCTTTACAAAGCTGTTTGTGTATACAGTGCGAGTGAACACATATGAAAGGTGAAACCGAGCATAGGCCTTTGCGTCTC
CGCCCTCGTTACCATCAAACAAACCCACGTATGTTATCCATCCTACGGGGTTGAAGATATTTCGTAGCTATTCGCGCTTTTCCAATTGAAGTAGCAGACC
AACGGTTCACCAAGAAGGTGGCAGAAATGTTTTTTTCTCCGTCATGAACAAAAGCAGCAAGCACTCCAAATACCGACTTTCCAATACCAGGACTTCCAAG
CACACGAATTTTGCAAAGTGGCATGATTTGGTTCGGTCTTGTCTCTTATATGGTACATCATAACTGACCAATCACAACTATGGAATGCAAATTAGCGTCT
TTCATTGGCCAAATGAACCAGCCCCTAATTGGCAAGCCCGGCCCCGAGTTTGCATTTCCCTTATGAGAGAAATCCTAATGACAACCCGTCTTACATTTGA
GCCAGTTGGCGGTGACCCGGGTCACACCAATGACCCGGTACTCAACTATTCTGTCATAAAACATATGCATTATTTAAGTTTCTGTAATCAGGCAATGCCG
ACTATCCTTTCGATGCAGCTCTGGATGCACTGCAACTTTGATCCAACGTCCGTGTTAAGCTAAATGATGTCGCTCCTAAAATATGATGTGTCGCCATCAA
TATCTGAGGTTACCGAGACTGAATTGTTGTTATTGGCGAACACCAGGAAAGTAACAGTGTACGTACTGGAGCCATCGCGAATGCTCCATAATACGACGGA
TGCGAACATGGATATCCTTCTTCAAGTTCCCATTCGTTACAGTCTGTAATTAGAAATTTCATGCCATCATCTGAGTAAGAGTGACTTGGGCGGCTACGCT
GGCACCGAGTGTGTAGAGTGTCGATCCAAACGCGCTATCTTGGATCCACCAACGCCGAATATCGCTCTAACTTGTGCGTCTGGAACGCCTTGGCCAGTCA
AGGAGAGAACCATACCCTCCGCCTGAGGGTGCTCGGTCCCGCCCCATTTGGATTCTAGTGACTTGTACGTGGCTTGTAACTGCTCAACTTTCTCAGTGCC
AAGTAGAGCACAAGCACGCTCAAACGCTGTCAGTCAATTTCGAGGTTTTTGTTTCTTCCGTGGTGCAGTCTGGCTCAAGCCACCTGTACCGCCAGTTCGT
CGTAGGAGGGTCGCTCATTTCAGCCAACAGTGGAAGGATCGCAGTCCAAACGCGAACTGTTACTGAAGTACCTGGTGCTAAAATTAAATAAATATTTCAT
ATTTTGTTCTCGTATTAGTTGGCGACTCGGGTCACCGCCAATCCCGGTCTTTAAAATCGTAACGTTACTGTCCGTCCGTCCGCCCACCTTACTACAAAAA
ATCATTGGTTAAAAATATATTTTCACATACGTACGATGTCCGACTCTTTTGCATACGTCATTTCGGAAAGCGCGCGGACGGCGGCAGGACACGACGGCAA
GCAGTTAGCGGCGGCGACAAGGACTGCGAGGCTCAATCATGTATGTGTTAATTAATATTATGTACTTTTCATCTTTTGCTCGGCCACCTCTCAAGCTCTT
CGGAGCCCGACGCTGGGGAGTCCATGTTCGCCTGCCAGCGGCATGGGAAGTCTCATATCCAATCCGGGGTAAAGGGCAGCATAAACGGCGATAAAAGCCG
GTTTTGCCGGGCTGTCTGCTCCTCCTCGTCGGTACCAGCAATGGTATATGGGACCCGGCGTATTGGGTAGTAACACCGGGGGCGCCTCCGAGTCCGGGAA
AACGTTAGCCAATTACTCACGTTCCCTGCTCGAGAACTACGACCAAGACGCTGCGGATGGACATCTCGGAGGAGATTTGGTTTGCCAAGAACTCAACGCG
TATCCATTGGAACAGTTGGAGAGTACAACTGCGGTTGTAGACAAGTTGAATGAAAACCAAAGGGATGTTTTCGACCAAGTGATGGGCGCAGAACAGCCTC
CCCAAGTCGGCCGGAAACTATTTTTTATTGACGGACCAGGGGGTACCGGTAAATCCTTCTTGCTCGAACAAATCCTTGCCAGGGTACGTCTGAATGGAAG
GGTTGCTGTGTCAGTTGCTTCCAGTGGAATTGCAGCAACATTGCTGACAGTGGGTCATACGGCGCATTCTACATTTCGGATTCCACTGAAACTAGACGAC
CATTCGACGTGTAATATTCCGAAACAGAGCCAGAAAGCGGAATTGATACGCCGGGCCAGTTTGATTATTTGGGGCGAGGCGCCGATGATACATCGAGCGT
GTTTCGAAGCTATTGACCGAACTTTTCGCGACATCACGGGTAATGAAGTCGAGCCGTTTGGGGGGGGGTAATGGTTTTTAGTGGTGACCATCGTCAAATC
CTACCGGTCTTAAAGGATACTACCAGGGCTGAAACGCTAAAGGTGTGTTTGAAAGCGTCTCCCTTATGGCAGCACCTACGCTAGCTTCGTTTGATAGAGA
ATATACGTGTGAAAACGGCGCTTGATCCAGATGGTGCTGCGGAGTTGGCCGAATTTTCGGAGTTCTTACTTCAAATTGGAGAGGGTCGAGCCCCCTTTCA
CATACGACTCCAACGCTGGCTTCTGCTTGATGCAAACCTTCACATACGCAGCCACCAAACTTCCATTGCAGAACTCGTAAAAGTCGTTGGAATTTTGACC
GGATACATCGAACTTCGAGAAGGCTTTGATGTATTTGGTGTTCACTTCCTTCCACATGTTATTAAGTCGTGGTGCGTCATCCTGGACGATGACAGAAGGG
TCGATCCCGATGTAGCGAGGGTCATTGAAGGTGAAGAGGCCATTGTAATCCGTTGTGTTGGTTTGAAACTCCTTGGCTACCTCCTTCGAAAAGGACGTGT
TCTGGTTTACCTCACCCGTGTCTATTTGGTCTCTCGTTGCCGCGTCGTCGGATGAACCAAGACGCGTAGCAAAACGGTCCGAGAAAAGAACATTGAGAAG
TCGAATGCAGCAGTGTTTTATTTTTTTTGCGCAAGCTTGGATCCAACAGGTTTTCATCGTCAACAGTTGCTTGAACTGCTCTACGTGTAGCATTGTGTCT
CTTCAAATGTTCAAAGAGCGCAAGCTTACCGAACTTCCTGGGCACTCGCAAATTTCTCTCGCTGCACTCCTTCCGCAGTTGAGCCACCGTCCACAACGTA
TAGTCATCACATGTAGGTGTCGGGACCGCTCCCGGATTTTTAACGGTCCAGTTGCGTACTTGCATTCCAATACGGTCGGCGGTGGTACCCCGGCTCACCG
GTTGTGAATCGTTATTACCAGGCTCAGGTACACCACGTTCTTCGGCGTTTGAAAGAACAACAGCGCGGTCGCCATCCTCCGTATAATTATGTTGTGGATA
GTTAGATCGGGGTTCACTGACTGCAACATAGCGGCATCTCCACCATTAATTTGGGTGCCACGGTCCGTTATATCAATCACGTTGCGCGCACCAGGAGCAC
AGTACCCACTGACATCCCTCCACCGGCAACACGGTCTCCACTAGCAACAAAGGGTCCACCAGCAGAAAAACCACCTTCAGCAACGCAGTTCCCAGTAGCA
ACATACTATTCGTCAGCAACACGGTCTCCATCGATGCCATTGGCATGGCGGTCAACAACATGGTCTCCACCAGTAGCACAAGCGACCGAAAGGCCTACGC
CAGCGACATGACCAGTAACAGTACCATGAACATGATCTCCGCCACCAGCAGCACGGTCTACACCAAAAATATGGCCTGCAGCATCAACTCCAACACCGCA
ACTACCTTTACCAGCTTCGCCTATGCGTAGTTCCGCACCATCATCGCGGTCATTACCTCCTCCACCGTTAAGAAGCCCACAAAAGTCACCACCAACAGAA
CGAGCTCCATCTGCAACATCAACTCACAAAACGCAAGTGGAGTGGACACAACGCCAACGAGCTCAGAGGAGGGTTTCCTGAGAGCATCAACAGGTGGCGC
ACCGCTTGCTGGCATGACCTTGACGCTCTTGGGCCGCCCACTTCGCGCGCCTGTGGTCCTCTTCGCGCTCTTGCCGTTGCCGGGCATCTTCGTTTCCATT
TTGGCCAGCAAGAATTGTTTTGTTTTTCTTTAATCGTAAAATTTTGTTTTAGAAAAAAAAAAATTGGTGGCAGTTGCGTTCCTAACGAAAAACTGCCACA
CTGCCATGACGCTGCGACAAGTATGCCATCGCATGGCAGTGGTTAAGAGCGGCCCTGAAGCTCTCGGAATGAGCTAGTGAAAAGTGTCTGCTGTCGATCG
TCGTCTGTGTTAGTATGCAGCCACTCCGCAAAGCGAGCTATTGCACGTAAATATGTGTACTTGGTCTTCTCCGCTGTCGTATTCTCCAGCACTTCTTCAA
CGCATGCATCGAGCTCGTCCATCGTTGCACTTAGCTCAGTGACCTTTCAAGAACACAAATATTTTTCAGCCAATCATAATCGTCAAATAATCTTAGCGCA
ATTTGCACGGCGAATTCCATCCATCTATACATGTAATGAACATTTTTTATATTTTCAAAGTGTACGCTGTTTAGATTGGCAAGCATTTTGTCTCCCAGAT
GCGGTTGCCCACGTACTGTAATCTGTATGACGTGTAGCGCAGCGAGATGCCCTGGAAGAGGAAGGCCAAGTAGCAATCTTTCTCCAGCATCTCTGCAAAG
CTCTTGCGATCCAAGACGTAGACGACGCTGCGTTTAGTTGCAATGAGGGAGGTCTTGCGTTTCTCACCCGTCAAAAAGCACATCTCGCCAACAACAGAAC
CTACCGAAACTTTTTCAGTAGTACCAGCCTCTTCCTCGACCACAGCAGTGAGCGCTCCATCCACCAACAAGAGTGCTCGATCCGAGGTGTCGCCTTGCCT
CCATACCACTTCGTCCTTGTCAATCTCCTGGATATGGAAGTAATCCAGCAGACGTTGTTGCACAGAGAGCGGTTGGTCCGGCATAAATCTTCGCAGGTTC
CGCAAATGTGTGAACTCGTCTTCATCAGCAGCACAAGTACTCGCAGGAGAGCCTTCTATACACGCATTCTTGCCCAGAATATCATCTTCACACCACTCAA
GCGCGCTGTCCAGATCCGAGGCAATGTGAAGCATACGATTGTCACCGAAAAGATCGATCAGATGCTCCGTAAACTTTGCATAAGCCTTTGGTACAGCAGC
AAACACAATCTTACAGTTGTGAGTATCGCATGCGTACTTGATCTTAGTGAGTCGATCCGCTGCAGACGAATCCAGTCCGACAACCAACGTGAAGTCAAGT
ACAAGCCACCGAATGTCGGCTCTCGGTCGAATGTCATCGCTAAGTACACTCTGAAGTGGAGATTCCACCCCACTGCTTGCGGTGTCATGACCTTCCGCAA
ATAATTCGCGAACGTAGTCGCTGAGCTGGTTGATGTTGCCGAAAAAAAGGTGGCCTTTGAGCTGCACGACGTGGATGTTACGGCACTCACGATCCAGCAC
GTCCAGTTCATCCGTCATGCGCCACGCATGACTACGCAGTGTTGCTGCACTCATACTGCCTCGAATCGGAGCGTTGGTTGGTGTACGTGCACTTTGCATC
ACGAAGGTCATACAGGCCAACAACGCACCGACAGCCAGGCCCTGGTTCATGCCCCAGAACGTCATAGTTCCAGCGATAGCCCACACTGTGCCAAGTTCCA
GAGCATCCAACTGGTCGTACGTATCAATGAGCGCTTCTCGAAGTAAATCCCATCCAAGATGCATCATAACACAACCTGCCATACACCGAGGGATGTAGGA
CACAGCATTGGGCCCAACAAAGAAGAAGAACATCATGATAAGTCCGATCACGAAGCCACTGCGACGTCCAGCACCTCCACACTTGTAATATAACGCAGAA
GTCGAATAGCAGAGGTAATTCTGCACAGTACCACACACTCCACTTAATGTGTTCGAGATACCGTGCGCAACCAGCTCATCGTTAATATCCACTTCCTTAT
CAGTAGTGAGACTCAGCGACGGGATGTTAATCGGCACGTGCATAAGCGAGAAAAATGTGAGACCGACGATCGTCCCGAACTGCTTGGGGATCACATGCCA
AGCAACGAGAGAGAAGTCGTACTGCTCCCATAGCGAGTAGAATGCAACGTTCGGGGCACGACTGAAGAACCAGCCATGTTCACGAGCTGTGTCAGTCGAG
ATACCAAGCAGCAGCAGAACCACGTAGAAAAGCGGTGGAATCGACACGAAGAAGAGCGGAGGAAACAGCGGCGACTTGATGTGGCGTGCAAGTATCCACA
GTGTGAGTGCCAAGAGCGCTGAACTGACCCAGAGCCAAACGATTTCTTCGTTAAAAAGGCCCTTAACACCGTCCCAAGACCAGTCAAATCCACGTCCTGT
AGCGTTCTCAATGCCACTCTGAAGCACGAAGGCGCCAATGCCACCGACAGCGCCAACGATAATGTGCTTCGGGAAGAGATATACAATATTACCAAGCTTC
CAGTGTCCCAGGATGTAGAATAGCGCTCCGCACACCACCGATGAGAATGCGTAGGTGACCAGAATTGTCGGCAGAACACTAGGGTTCTTGGGTCCCAGTT
CCTGGATAATGGCCACGGAAATAGTGTGCATGAACGGCACGTTCTCGACCATCATTTGGCAAATGGCTCCGTCAAAGTTACTGAGCCATACGAATGTGAA
CTGGCAGATCGTGGACGACAGTAAGAACATTTGAATACCGAGAGCATGCGGCACAGGGATGTCCTGCCACTCCAACGGGAAGAAGGACAGTCCAAACGGG
ACACAGATCATCAAGTTGACCAGCACTGCGATGACGATACAGGGGGTAGCGTGCAGAGCTTCCATGACGCCGTGTTCCCAGCCGTTCAGCGGGTCACTAG
CGTCGCGGTGTGAACCCCACGAGTCCACGGACAACCTGGTCGTGCCGTAGGGCGAATAACAGTGCGGAGACGCGGCGTTGGGCGCAGTGGTTGGCAGTGT
CTCGTTGGCTGGAGACTGCGCGGTTGGCTGCTTGGAGAAATGCAGTGAGGTGCCGCCAGCGTCGCGACGCAATGGCGGAGGTTCGAACACCATGTGGGAC
GGCGCATGAGTCTGTGTGGGGGTGCTGCGACGCGGCGGTGACAATAACAACTGACGCTCCTCGTCGTTGAGCGGCTCCATCGTGTGACGAGACACGTTTG
CTTGAGGTCTTGCAGTCTATGGAGCAAATTGACGAGTGTGAGCAAATGAGGAAGCCACGGTAGATTGTGCATTAGTGACGTACGTGTCTACCTCATTTTC
AGCAAATAAGATTGCGTTCTGGGACGACATAGCCAATCGCGTGCCAGAGTTTTATCGGAGACTTTCCTATGTTTAGCTGTCCATCACCCTTTTACCTCCG
TTGCAGGTTGACTTGTGCTGAGTATGTCGATGGACGTTGGGCGACAATGTAAGCGGAGGATTGCAACCACTGAAAGGATCCCTCCATTGCGCTGGCTGTA
CAAGGCAACATGTGACTTCAGGATGGACGAGATCTATGGCTGGGATATCTTGCTTGATATCCTGCCGGCGGCAACGCTTGCCCAATTGTTGCGATCGAAG
TGGTCAACGTGGAGGTACAAGTTGCCGTCGGCACAAAATACGAACTCTCACCGAAAAAAAAAAGCGCCGACAATCTGGTGGTGGAGGCACCGTTATAATG
AAACTCACTGATACATTTGGCGTACTCGGCGTAATGTCGGTAGTTTGCGGCGGCAAGTGATAACTTGAAAATGCTCGCCACCTTCGGCCACCTTCACGCT
GACAGACGCTTGCTCACTGAGCAAACGTCCAATGAACCGAGCTCACAACGGCTTCCATAGTTTTGGAAAGATACTTTACACGCTCATTGAAGAGTTCACA
CTCAAGAATGCGAAAGTCATGACTCCAGTGAAGTCGTCGAAGCATCCAACAAAACGCCAAGTGTCAAAAAGAAAAGGGTAGTAAGCTTGCATTGACGCAC
AACTCTTTTAGCTTTCTACCTCCGATCTGTAAGATGCATACGGGCAGTCACTCACTAAAACTATGAACAGACCGACCTCCGCATTGTCGGCGCCTTCTTT
TATGATTTTGCTCCACACAGAGCCCTCTTTAAATCTTGCCAGTACCCGAAGCGTTCTGGATAACAGCACGGATGGCCTTCATCTCCGCCTCAAGACGCAC
GAGGCGGTCCATAGCCTGTTCCAGCGTCATACTGCGCTCCACGAAAGATCCACCCACAGCGCGTCCGGCCACGAACGAGCCGCGCATGAACGAGTCGTTG
TTCAGGAAAGAAGAGCCCATACGGATACGGTTCTGGCGCTGAGCCTCCTGCTTGACGTACTTCTTGCTGCTCACCTTGCGCTCAAACACATTCATGTGGT
CCACGTGCTCCAGCAGGAAGATCAGCAGCACCTTGCCCAGATCCTGGATGAAGAACCAGCACAGACAGTAGACCCAGACGAACACAGCCAGCTTGAACGA
GATAGCCTCCATCTCCGTGAACGGCCAGAAGACAGCCAGAAGCGTCGACACAACCGTAGCGAAGCACGCAGCAATAGCCAGAAGGCGGCCAGGGGCACGC
GTGAAGAACAGACCGTCGGTACGGGCCGTGAACACCGTCATGAAGTCGGACAGCGAGATCTTGAGGTACATCATCATCATCACCTGGTCGTACGGAAGGT
CACCCAGGCCGAAGTACGCGAGCATTCCGTTCTTGTCCCACGAGTCGAGACCCCAGAAGAGCAGCAGCAACGAGCTAGCAACAGCAATGAGGCCGAGAGT
TGTCGACACCCAGTAGATACGGGGCAGGTTCCAGGTCTCCGGGCGCTTGGAGGGCACCACATTGTCGTAAGCAATCGAGATAATCGTACCGTCGTTCAGG
ATCGTGATCAGCACAAGAGCGATGACCGGCAGCTTGAAGTACGGGTCCACAGCCTCCGTGCTCTCGTTGTTGTTGTACGGGCACTCACCAACGTGCGGGA
CGAAGTGCTGGAAGCGGCAGCTGTCCGGGTGGAACAGCAGCACCGAGATGAAGAAGAACATGAGCAGCTGGATCGTGCAGGCAATACGGTACGTCACGTA
GTTGCGCATACGCTGGAAGATCTTACGCGACAGAGTGATAGCGTTGATAATAACCGACAGACCAGGCTGCGTCAGCACAATATCAGCCGCAGCACGTGCA
GCATCGGTCGATCCCTCCACAGCAATACCGACGTCAGCCTTCTTAAGCGCAGGAGCATCGTTCACACCGTCTCCAGTCATACCACACACCCAGCCACGCT
GACGCAGCACTTCGACAATCAGGAACTTGTGCTCGGGGAAAACCTGAGCGAAACCATCAGCACTCTCGACAATAGCGCCGTAATCCGAGCCAAGAGTCGA
CGAAAGACCGTCCTGAACATTGGCAGTGGGCAGTACGTCCGTGCCCAGGATAGTCGTGCCCATTCCGAGCATACGGCACGTCTCCACGGCAATAGCAGCC
TGGTCACCGGTGATCATCTTGACGCCAATACCGTTCTCGTGAGCCAGTTCAATAGTGCGCTTGGTGTCGTGACGCGGAGGGTCCAGGAACGTCATGATAC
CCAGGAACACCCAGCCACCGTCAGCCTCTTCGTCCGAAGTACGACCAACAGCGAGCGAGCGGATGCCACGCTTGGCCAGGTCGAGTACCTTGGCTTCAAC
TTCCTCCTGGATCTCCGTCACATTGTGAGCAAGCGCCAGAATGATCTGAGGAGCTCCCTTGGTAACCTTAAAGACTTTACCGTCAGGGCCGCGGATCGTG
GACTCCGTACGCTTCACCGACGGGTCGAACGGCATGTGGTCCATCATCGTGTACTGGTCCAGCGGACGCAGGTCAATAGCGTTCAACACCAGCGTGTCCA
GAGCATCCTTAGGCGGCTCCTTCCACTTGGCAGCAAGAGCAGCAGTAACCAGCACTTCCTCACGAGTAGCAGTCGGGTGGAAGATGGGCAGATCGTCCTG
CAGCTCCATCTTGTTGCGGGTGAGTGTACCAGTCTTGTCCGAACACAACATGTTCATACCCGAGAGGGTCTCAATGGACTGCAGCTGCGTAACGATGACC
TTCTCCTCTGCGAGCTTACGGGAGCCAAGAGCCATAGTGGACGTGCATACAACTTGCATGGCAATGGGGATGGAAGCCACCAGCAGCACGACGCAGAAGG
CAATAGCCTCCAGGAAGTCCTCGCCATTGTAGATGAGGTAACCGAGACAGAAGCCCACAAGCACGAACGAAATGGCCATGAGGAACATGGTAATGCGGAT
CAGAATCTTCTGGAAGTGGCTCACTTCGTCCACGGACGAGATGAGACTCGCCGTCTTGCCGAAGAACGTTTGGCCGCCTGTAGCGGACACCACAGCCTCC
ACCTCGCCACGTACGACGGTGGAGCCCATCTTAGCGTTGTCACCAGTGGCCATCGTCACGGGGAACGACTCGCCGGTCAGCGCAGCCTGGTCGATCTGCA
CGGGGTTGCCCTCGCACAGATCGCAGTCAGCGGGCACAGCCGAACCGGCCGACAGTGTGATGCGGTCGCCCGGCACGAGCAGAGCAGCGTTAATAGTTTG
GTGCACGCCATCGCGGATGACCTGAGCCTCAGGCTTGAGACTGGCCTTGAGTGCAGCGACGGCGTTGCCGGCCTTGAGCTCCTCGTACCAGCCCACGATG
CCGTTGAGCAGCTGCAGGAAGAGCAGCACGAAGAAATCAGGCAGATCTTTGGTGATGGCCTCGACGAGGATGGCGAGCCAGATCATGATAGGCATGGGGC
CCCAGAACTGCTCGGCCAGCTTGACCCACGGGCTCTTTTCCTTGGTTTCGAGCTCATTAGGGCCGAAGATCTTGAGTCGACGAGAGGCCTCCACGGTGCT
GAGACCAGCCTCGCCCGTATCCAGCAGCGAGCGCTTGTCCACGCCCATATAGAAGCGGTCGTCGTTGCTCACACCGCTGTACGAGTGCTCGTCGCCGTTG
GCGAGCAACGGACTGTGCTCCGACATTGTCACTTTGGTCTTCTTCAACTGTGGCGATGTGGGGGAAAACGAGAAGTGAGCGATCCGATGGTGTCCGGCGG
CAGAGCTCTCTCTCCCTATTTATCCAGGACTCAAAAGATTCGTTTTCGGAGTGGACCAATCAGAAGCGCGGAATGGTGGACGCGCCCCATCTCCAAAATC
CGTTTTTTGTGCTTTTGACAACAATTGTGGCGACCAAAAACTCCGATCATGCTTGCGGTGGGGTCAGTGAGAAACCCAGCTGAAAGCGCAAGCGAAGTTA
TACAGTCGTGCTAGGGTGTATGCACCTTGTACAAACTAACTGTAACTCTGCCGTGTGTGCGGCACGAGACGCCGGGCCTGCAGCTGATGAAAATAATTTC
GTAGCGGATACTGCGCCCAGATGGCAAAGTTTGGAATTTGATCCCCACACACTGTGATTTTTGCCGTGTCAGGTATCGCAGATGTGAGACCAAGTGGGGG
CGCACGGAATGGGCAAAGCTGAAGATTTATGGCGGATCCACCGCCACAACACAAACAAGCTCGCTCGCTTTTCCCCGTGGACAGCCTCGAGATCGCTCCA
CTTGAAGTCAGATGGTTCACGAAGTATCCACACAAATCGTCTGCAGTGTCGAGCTCAGTCCAGTTCGGAAGCAAATTCTTCGCCGGTCTGCTTGAGACGG
TGTCGATATCGCTCGCCGCAGTCTGCGCTGGCGTTCTCACGCCGTACATGTTCAAAGTCTCAAAGTTTTCCTGCTGAGCTTACAAGAATTTTGGTAAAAC
CAATGGTGAACGTCAACGTTTTTGGTGGTCTGCTGCTTGGTTTGAACGCTGCCCGTTAGTTCAATAATTTGGCTGCTGCAAGTATGAACTCTATACAATC
TAAGCGGGAGCTACTACTATCCTAGTATGTCCTTTGCCTTGACGCCCGGAGGCAGTGTGGACTGGTGTTCCCCTCCAAGCATATTACTGAAGTCCCAACG
CCACAATGTTTGTGCCGCAAAATAGGAGACTCCAAACACCCTTCGAGTCAAAGGGTTGATCCGTCAAACTTTGACGGATCGTTCGGTGCGGCAGAGTACA
TACAACGCAATTTCGCAACATCACGAGTCATATGAACTGGTTCAGATTAGGGTGTGGGCAATTGTGGTGTGCAACTAGTCAATGCGCATGTATCAACTAT
TGTTCGCTCGTCTTTAAAAGCTTGGCATCAGCTTCTTCAGCGGGCAGGGGCGTTTGTATTGCGGAGGAGTGATGTAGCCCTCCTTGCCCTTCGATGGGTC
CCAGTAAAACTCGTAGGCGAGCTCATCGTTGAGCGGCCATTCATTCTGAAACCTTTCCACCAGATCCGGATTCGACATGAATCCGCGCACAAAGCTCACC
AGATCAGCCGCCCCGCTGCGAATCGCGCCCTCCGCGGTGTCACGAGTATAGCTGCAGTTGGCCATGACAAATCCCTTAAAGTGCATTTTGGCGTCGAGTA
CAGTCATCACGCGGCTATTGTCTGAGTAGCCGAAGCCAAAGCCATCTAAGATAGCTAAATATCCCAGCTTATGCTCAGACAAGCGT