Description :
From Genome Similarity Track
Location :
Scaffold_105:26433- 30766
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_105-snap-gene-0.31MRNA transport regulator (Mtr10)
Pytul_var.sporangiiferummaker-pug3_contig_105-snap-gene-0.41Dihydropteridine reductase

Sequence
4333 bases(100 bases per row)
AGATGGAGGTGAGTGTGGTGTCGGAGGCGCTGAGCCAGCTGTACAACCCGCTGAGCTCGCCGCGCATGCGTCGCCGAGCCGACTCGCTGCTGCAGAATTT
CCAGCGCACGCCCGAAGCCGCACAGACGGCGCTTCGCGTGTTGCAGGCGCCGATCGTCGACAAGGAGTCACCGCAGCTGAAGGCCGAACGCGCGTTCGCG
GCGTCCACAATCTACTTCACGGTCGCATCATACGTGCGCAAGTACAAGTTGGAGAACCCAGCGCTGTGGACCGAAGACGAGCGGCAGCAGCATGAAGCGC
TCTCGAAGGAGTTTGGCGTGCTCTGTCAGGAGGTGTGGAACATCATGACGGGGCCCAATGGGATTGCCGAGGAGTTTAATGTGCAGACCCACTTGGCGCT
CACGATCGCCGTGATCTTGCTGCGGTTTCATGAACAGCACTCCGAGTCGACGATCGTTGCCGCTGTTGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNACCCGATCCAAGACGACGTGACGTCGAATTTGACCAACTTTGCGATCCTTCTCACGCTCAAGGTGATCCCGGAAGAAGTCGAGAACAAACGCGTCAAG
TTTTCCAAGACCAAACGCGCACAGTGCGAGGTGATGGTGCACCAGTCGGCACCGTACGTCGTGAAGACCGTGCTCCCTACGCTTGCGAGGGCGATTGATG
CCGACGACAAGCAAGTGCGGCTGCGTGGGTTGCTGCTGAAATGCTTTTCCAGCTGGGTCGAGTACGGAAACGTGCCGCCGACACTGATCATGGAGTCAGG
CTTACTCGATCGCGCCTTCCAGGAGACCATGTACCCGGCGTTCTCTGAAGACGCGCTGCTCGTGATCCGAGAAGTCGTACGTGCGTGCAACAATAACGCG
TGCATTCCGCTCATGGAGCTCGTGATGAAGAACTTTGTACTGCTGGGAAAACACATTGTCGAGCGACTCGCGGCCAATGATGCTGTTGGGTATTGCCTGA
AAGGCTGTGCTGTCGCAATGGCGGAATGCGGTCAATCGTTCATCATGTATTTTGTCGACTGCACTTTGGATTTGCAGCCAGGCTCATTAGTCTACGAGTT
CCTGGACACAATTTTATACTTTACGGCGATGAACGATCTCGACATCTCGAACGAGACGATGAATTTTTGGATCGATTTCCGCGCGTACATCTCGGGCAAG
CACGAGCGCCGCATGGCGGACTTTGAAGCGTTCATCTCGCGGTTATTAAGCATTTTGATCGAGCGAACCGAGTTCCCAGACGACTACGAGAGCTTTCCTG
TGGCAGCACGAGAGCGATTCATGAGCTACCGGAACGACGTGCGCGCAGTGTTCCGATCGCTCGCGACCGTGACCCAGGCGAGTGAAGACAAGTTCGTCGT
GGACGCGATCCACGTCATTTTCCGGCAGTATGAGCTCTACGACGCTGGCCACGCGACGCCGACGTGGTGGAAAAAAACGGAGGTTTATGTGCACGCGCTG
AGCGCGCTGTCCAAGTCGATCCGCGAAGAAGACACGTCGCTGATCCCGCATCTGTTTAAGCTGCTGGCGCGGAAGGAGCCNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNCGATCTTTCTGGGCGTCATGGGCCACTGGTTTGCGCGGAATCCAAGCTTTCTGAGCATGTTCGCGTTCGAGATCATATC
CCAGAGCTTCGAGATCCCCGAGAGCCATCCGACGTTTCCGTTCCGCTTGCGCGAAGAAGATCATCTGGGCACAGTCGCGCTGAAAAAGCTGACGCATCGA
TGCGGTGCCCATTTTTTCAACCAGCGGTGGCTCGACGCGATGCTGAGTCTGTACCGCACGAACCGCGCCACCAAGGGCACGAAAACCGCGTGTCTCGACG
GCAACAGCCTGCAATTGATCGTGGAATCTGTCGCGTACGTGGTGGCGACTGTGCCGTACAAGGACGCCGTACCGGTAATCGAGGAGCTTTGTGCGATCAT
GTTCCACGACCTCGCGGCGCGGTTCCCGACGCTGAATGCTGACGATGACGAGTGCGTCGAGTTCCTGTGCGTGCTATTTGCGCATCTGCATGTGTTGGCC
GTGAAGATCCCGCCGCAGATTAATCAGGAGGTGCCGCATCCGCTGCTGTGTGCTCTGCAAACTCATTGGACCGTCGTCGAGGGCATTCTACGCGTCTTCG
GAACGAATGAGGATGTCATAGACACGTTTTGCGGGATGCTTGTCGCGTTGTTTGATTCGATCCGATCGCAGGCGCTCGACCTCGCGTCGGCGATCATGCC
GCATTTGCTCGAACAGTTTGCACGCAGCTTTGACGGCAGCTTTTTGAACGTGATCAAGAGCATCATCGCGTGTGCGGGCGATGACGACGGGTCGATGGCG
AGTCTCACGCACGTGCTCGTGATCGTCGTAGAGAGCGCACTAAGCCACCTCGCGACCGTGGACAACGCCGACGAGAGCGCGTCGCTGATCGTGTCGCTTC
TGGACTTGACTCGCAGCTGCGGCTCGCAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCGCTCGAACCAACTGGAGGCGCTGCTGGTGCTCG
TGCTGCATTCTCTCAAGTCACAGAACCCTGAAGTGGGGCAAGCGACCTTGGATTTCTTACTGGAAGTTGGCTCGTGGTATGGCGAAGNNNNNNNNNNCAC
ACCTCCGGAGCTGCTGCGGTTGAGCGAGTGGGAGGGCAAACTGGAGCTGCACCAGCTTATCCGCACGCTGTTCTTTGAAAAAGACGTGCAGTACCACTTG
CTCGTGGCGCTGTTCAACGCTGCGGGGGGCTCCATGCCACCGAACCTCATCGAGCGCGTGGCTGAAGTCGTGCGCTCGTNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTGCTCGCGGACGATGGGTTTGTGGGCGCCCACGTCGCTGTACGAGCACGAAACGAG
TTCGCCGGCACGATCTCCAAGCCCGAGTGTATCGAGAACTCGCGCAAGTTCAAGCGCGTGCTCACTGCGTTTTGCGATCATTTTCGGAAAAGCCTTAACA
GCACGAATGGCGCCATTCCACCCACGACTGGCATCATGTCCTCGTAAGTATTCCCCCCTCACCACCACACACAAACACGCAAACGAATGAATGACAAAAC
ACCACCAAATGAATGAAACCATTTGAGCCATGAGATGCAGTAGCACATGAGTGCACACTACTGAATCACAAAGAGGACGAGGCACAACAACACATTGGAA
AAAGGTGCCAAGCTGACGACGAAATTGCGGCTGTGATGCATTAAAAAATGTGGGGCTCCTGCGTCGACAGAATGCAGAGATTATAGACCATATAGAGAAC
AACGACTTAAAGAAACGGGTTACCGGCGTCCTCCCACGTGTCCACGTTGTTGTTCGTGAGCACCGTGAGCAAGTGGCCATTGGGCGGACGGGACGAAGGC
GATGCATTGGACCACTCCAGGATCTTGGCCGCGATCACGTCTACTTTGGTCCAGGACGCGTAGTCGGCGTCCNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNTCGATCGTCGCAGGCAACACGCCAAGCGCCGTCGCGTTCTCGGGCAGCGCGTCGATGCTGCTCGCGATCAAGTGGTGCGTGCCAGCCTTGCTGATCCC
GTACGACACCATGCCAGGCGTAGCTAAATTGTTAGAGGATAGATATACGGATGTTAATGCTCATAAATGCATAAAGCCCACACGAAAAAGACAGCAAATG
TACCTTTTAGAGCAGCAGCAGCGCCAGTGAGCACAAGCAGCCCACCGGGGTTCAGCACATGGCTCGCGAGGTGAGCAGCTACGCATNNNNNNNNNNACCA
TAACAACACCATGAGCCATATTCGCATGAGCAACATGCCAAATAGTAGATGGTCGTACCCATGACAGCGGATTCGGTGTTGCGCGAGTGCATCTGCGCGA
GGTTCACGAGCGTGTCTGCGTCTTTGATGCTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCCAGCAGCGCACACGACGGCATCCACTTGGCCATACC
TGCACGTTACCATCACGTCAGATCACCACTACCTCGCATGCAAAACGCACATGAGAACAACTCAGCGCGTACGTGTCCTTGATGTGCTGCAGCACGGCGC
TCGCCTGCGTCAGTGTGCTCGACGCCGCACGGTCAAACACGAAGCTCGCGTCGACGTCGTCGTTGGCCGTAAAGTCCACTGAGAGCGTCTTCCATGCGGA
TGCGCGCGTAAAGTGCGCGCCGATGCCGCGTCC