Description :
From Genome Similarity Track
Location :
Scaffold_21:26428- 31443
Transcript NameFunction/comments
Phyke_g1350hypothetical protein PHYSODRAFT_536864
Phyke_g1351hypothetical protein
Phyke_g1352hypothetical protein PHYSODRAFT_466952
Phyke_g1353hypothetical protein PHYSODRAFT_554422

Sequence
5015 bases(100 bases per row)
GGTGTCTGCCTGTGTGTCCATCTTGCAGGTAGCCAGTCGTCGTGCGGAAAGTTAGAGAAATTTTTGTTAGCGTGAACTCGGTCTTCTCTTTGGTATGTCT
ATTATTCAATGTAGCAGGCCGGGCTTTATGCGAACGAAGATACCTTTGTTGTCATGTGTGCGTTGCGTTCCTATTCATAtcttgttttttgttgttaTTT
GATCGTACGACTTCGACTTGGCAAACTTGTTGTTTATAATGCTCATTTAGACATTTGACAGTGGTGATTCTTTGCGCGCGGGGTCATTCTATCGAGTGCT
ACTACGTCTCGACGCGTACTATGATGGTACGGCAAGCTGCTCGATAAAAAAATGCTTACCACCTGCTTTTAGTCTTCCACGCTTGAATACACCAACCTCG
AACGGAGGTCTCGCTTCTGCGATGTACTCACTCTCACtttcatcgtcctcttcctcttcgtgcTCACGACAGAAGATCCCACGACCTGACGGAGAGCCAT
TAACCCACATACCAATAAATTTTCTTCCATCGGGAGACGACCACGAACCATAACCTTGAATTACGCCCTTGACCCAGTCGCCATCATAAGTTTCCCCTGA
GGCGAAGGTCAGTGTACCAACGCCACTTCTTTCACTAGCTTTGAATCCACCAATGTAGGTGCTCCCACATCGAAAGTAGTGCACACCCTGGCCGTTGAGT
TCGCCGTTTACCCAAGTTCCGTGAAGTGAGCCCTCCATCGAAACGTAAACACCCTTACCGTGCATCATACCTTGGTGCCATGTGCCCTCATGGGTGTCCC
CCCCTACCCACTCATACTTGCCAAAGCCTTCACGCTCCCCCTTGCCAAAATAGCCTTCATACCTATCTCCCGAGCTAAAGGTTTTGATACCCCACCCGCT
AACCAGGTTGTGCCTCCATGCACCATCGATCGTTTCTCCAGAAGAGAAAATCTTCTTGCCTTTACCGTGCATCACTCCTCTCTTCCACTCGCCTAGACGA
GATAGAACAACGTCAACTTTTATACTCGAACAATCTAAGTGCCACCCTTGAGGCTCACCATCATAACTGTCGCCAttcttccagaagaaggTGCCATTCC
CATGCATCTGCAATGAGATAGAATCCCAACCGGCACACCACCACGCAACAGTCCACGGTCAGCCCCAATAGATGCTACCGTCGTTTGTGTAGCTCAATTC
CCACCTTCCCAACACGCCAATTGCCGACGTATTTGTCACCATTAGCCCACAGATACGTTCCCACTCCATGCCGGTGATTCTTGTGGTACATGCCTTCGTG
GCAATCACCTGTCCCCGCAAAGGTCTGCGAGCCGAATCTATCGCATAGCCTAGTGAGTCTTCAATCAACTTATCACAGTCTTCCAACATTATGACGCACC
CTTCAAACACTCCATGCACCCATGTACCCTTAAATACGTGGCCCACACATACAATGTACACACCAGAACCATGACGCcgctcgtcctcgtccacgtCGCC
TTCGTAGCGACCGCCGTCTACATATTGGATCACGACGGTTCCTTGAGGCTTCTTCCAGCGGATCGACAGAATCTCTGACTGCGTTCTACAGCGACCATAC
GGGGCTGACGTGTCTTCCGGCTGAGTCTGCAcctgctgtttcttcacaCGGTCTGCAGCGATCGGGTTCTCTCTGTACGCTACAGTGCGAGATGCCCGAC
GCCGCCCGCGGTTGCCCATGGCCGCAGCAACGTGGGGCGAGGAATTGCGGAATGACGTTTGAGTCAAATATGAGTGCTGAAAGGACGCACGATTGGTTAA
AACCTTTTTtgtgagtgatggtcaccCAATTTTAACCAACCGCCGCATGACATTAGCGAGCAACAACTTTTGAATCTGCAAGATGGCTCTCCTCGATGCG
CTCCTGCCCCTCCGCCTGTTCCTGACGCTCGTGTGGTGGCACATCTGCCACTTTATAGCGCATACATTGCACGTGAAGGGTATTAAACCCTCCAGCCAAT
TCTTCCAtaaggtggtggtgatcggCGACGACTTTGCTGCAGGTATTGGCGACTACATCACGATGGGCAGCGCCGGAGGAGTCGCCGAGTATCTGAAGTC
GATCGTGGCGTACAATGACAAAGTACGTTGATTATAATAATTTGTAAGCTATGCTACATCTTGAGCTCTTAAAATGAGCTCAGCAACCTGCTACAGTAGT
TATATCCGTTATTAATAATTACAAAATACTTTTTAACTTGCTGTAGGTTCGCCACAACTGGGCGATCATCAACGCCGGCGTGCCTGGATCCACTACGGCA
GATTGGATGATGTCGTCGCCCAAACAGGTGAATACAGCACTAGTCAACATTAGTAGCCTTACAGTGTGTATGAGCGTGCTTGAGCTCGCTCTGTCATATA
ACTGCGCTCTAACAAAACAATAATGCTTTACGAGTTAGTACTTCAAGAATGCGCTTACCTCGAGATCCATGGGTGATGCGTCGATCGTGATCATCATCCT
GGGATCCGCGGAGCTCAGGTGGGCAACAGCTTGTAAATACTCGAAGAGCTACGCGTTAGAAGCCCCAATAGGCCTAAAGCGAGTGACTGACGTGGTACCA
ACCGTTGTTGTCTTTGTTCCTGTGGATAgaaacccagcagcagccggGCATGAGATGAAGCGCAACCTCATGGAGATTTGCGATACACTGCGGAAGAAGG
GTAAGCACGTGTGTCTGGCCACTGTCGCAAGCCCCGACCCACTTGCCAGTGAGACGGACTGTGCCAGCTCCACACTCAACACTGCACTGGAGCAATTCTG
CAAAAGGTATCTGGAAACTCGCTTCCACCCATGAGGAAGTGCCCAGTGGTCCTTGAAAGCAGTCAACTAACCGTTGATTGTGTTTGTGGCATCTTGAAAG
TACATTAACGGAAGAGGCGCCTGTAATTTTTGGCCCTCGTCTCGACAACTATGCGTTTCGCCGTGAAAATGCACTTTCGTACGATAAATACCATTTCAAC
TCCCAGGTACGAATTTGACATTGCCCGAAGTTCCAAGCTGTCAATATTGAACCGAGATTTAGCTCACACTCCTGCTCGTGTGGTGGAACCTTTGCTTCAT
CAGTCGTACCGACTGCTGGCTCGCAACACGGCGGACTTCTTAGTCCCCATGATGACGGCCGAAGAATGGGCCACCTGGAAAGAGCAGCTAAGCCACGTCA
CGTATGACAAGGCCTTGTACGAGTAAGGCACAGTGGCGGCCACCGTTGTTGCAGACACCTATAACGGTCCTCTGCATCAAAACCCATTGCCAGCCACACC
AGGAAAGAAGACACAAACGACTTTGTATCCACTTGTTCCGAGGTTGTCGTGGGTTAGCCGGCTCGATTGCTCTTGTACTTGGGTCGCCCATCACGCAGAA
AAGTTAAACAATAACACCACAGGAAACACGCGAGCTCATCTTTTTTCTTTCGATTTCGGTTTTTGGCACGTCCTCGCCACCTCGCCTTCCCACTCTCACG
AGGTCCATGCGAGCCGCTCGTCATCTCACATGTGATCTTCACAAAGTGTTCAATCCACTCCAACTCTTCGTTTCCATGCCTTCGATCTACATGTCCACGT
ATTCTCCTTCAATGACTACACACCGCCATCGCATCATCAAGACTCCATAGTGGCGTCAGCAGCGGCGTCGTCACCTTCCGTCTTGGTGCTATTTTCGTGC
GCTGGCTTCGCAGCCCAGTACGCCTCCATCTGACGGTCCAGTTGCGCAGCTTTTGGATCCGGACCTTTCCCAGCTTCATGCCAGTACTCGTCCATCTCCA
TGTCAAGGTCGTCGCCGGTAGGAGGCTTCGCCTTGGCGTCACCGCAGCCGCCACTACCGCCACGACCGCCGCGTCCTCctcggccagcagcacctcggcc
agcagcacctcggccagcagcacctcggccagcagcacctcggccagcagcacctcggcCCCCCTTGGCTTCGTTCTGTTGCGCCGTCGGCTTCTTGTTT
GCCAGTTTGTTCTGGTTTCCCTTGGGCTTGGCTTGCTGCGGAGTCAGCCCTTTCCTGTGCTTGCCGACGACCAGCTGGCGCTTGGAGCGGTTGGCttgca
cttgttgctgcagcttctgacgttgctgctgttgctgctgttgctgctggaccTGTTTCTTGGTGGGGGCTGGCGCCTTGTTCTTCTTACCAGGCATGCG
GAGCACTGGCTGCTTCTTCTTatgttgctgcatctttaCGACTGTgacttggtgctgcttctccgTTGGACGCGGCGTCTCGTCCGTCAAGTGGGTGAAG
CGGCTAGACAGAGGGATGGCCGACACGCCAATCACGGTACgtggcgtcttcttgctttgcTGGTCGATCTTGCGTTGGCCGCGGACGGACGCGCGTGGGG
CTCCGGATCTCCGATACATTTCTtcagttggtggtgcttgttcCTGCTGGTTGGTGCTTTTTATACTATGAGAAGAAATGGGGTTTTTATCTGGGTTCAA
AATGTTGCATGAAGGTAAACTTTTGAAATGAATGTCGCACGAACGTGAAACGAAAGACGCCGGATCAAAACTGACCAGACGccacgatggcgatggaggc
GGTGCTGGCGAGGCAAGTGCAGCGCTATCTGGACGCCTACGTGACTGACAATGCGCGGTTTCTGGCCGAGAGACTTGTTGCGCATGTAATGAACCCTTAA
TAGCGCGTTTTGGATCGCGGGAAGACGCATAACATGGATTTATAAGCAATACTAACGATTTTTATGATACATTTTTGTTTCTCTTTGTTTGTTGCTATAG
CATCCGACGGAAGAGAATATTCTCTTGTTAGCTACGTGTTACTATCGAGCCGGTCAAGCGGCCAGAGCTATGGCTGTGCTGGGTAGAGCTACAAGGCCGG
AGAACCGCTACTTGTTGGCTTGTTGCAGCTTTGAACAGGGTCAGTTCACAGAGGCAGAGAACGCACTGCTGGGAGGAGAGGATATAGACGACCAGGATGC
TCTGGACAATGTAcc