Description :
From Genome Similarity Track
Location :
Scaffold_86:26428- 28151
Transcript NameFunction/comments
Phyag_g1812hypothetical protein PHYSODRAFT_536864
Phyag_g1813hypothetical protein

Sequence
1723 bases(100 bases per row)
CCAATCTCAAACGGTGCTCTCGTTTCCGCGATCAGCGCGTCTCCCtcgtcggcttcttcctcttcttcgtcatcgtgcTCGCGACAGAAAACGCCACGAC
CAGACGGGAATCCACGAATCCAAGTACCGATGAATTTCCTGCCGTCAGGTGACGACCATGCCCCATATCCTTCAATCTCACCCTTATGCCAGTCACCTTC
GTACACTTCTCCCGAGGCGAATGTCAGCGTACCAACGCCATTCCGCTCACCAGCTTTATACTCACCAGTGTAGACACTCCCGCATCGGAAGTGCTGCACA
CCTTGGTCATTCAGTTCGCCGTTGGTCCACGTTCCATGCAGGGATCCTCCACCTGAAATGTACACACCTTTGCCGTGCATGGTGCCTTGGAGCCACGTGC
CTTCGTGCGAGTCTCCTCCCACCCACTCGTACTTGCCAAACCCTTCTCGCTCACCCTTGACAAAGTAACCCTCATACTTGTCCCCGGATGCAAACACCTT
GACGCCCCACCCATTCACCAGATTGTGTCGCCATCCACCGTCAATCATTTCTCCCGACGCCAAAATCTTTTTGCCTTTGCCATGCATCATGCCCTTCTTC
CATTCACCTGGCAGACGAGCAGCATAGTGCACACACTTCAGCTACCCGATCAGGTTGGGAAAACTGACAAGTGTTGCCCTCTTTGGAGATTCTCACCATC
ATAGCTGTCTCCGTTCTTCCAAAAGAACGTGCCATTTCCATGCATCTACAACCAGCCCAAATTCACCCTTATAAATTAGCATCCACAACTTGCCCACCAG
TCTTGCAAACTCACGAGCAAGTACCTTGCCGACTCGCCAATTTCCAACGTACTTGTCACCATTGGCCCACAAGTACGTCCCTGTTCCATGCCGGCGGTTC
TTACGGTACATGCCTTCATGGCAATCACCCATCCCCGCAAAAGTCTGCATACCAAACCTATCAACAGCCAGCGTATGATTAGCAACGGATAGCAATTCAT
CCATCGCCAACTCAAAAAGAGTCCCTGGCGACCGCACCCTTCGAAGTCTCCGTGGACCCATCCACCGTCGAAGATGTGACCTGACATCTGTATGTGGACG
CCGGTGCCATGTCGACGTTCTTCCTCATCGACGCCTCCTTCATAGCGACTGCCATCTGCGTATCGGATCACGACAGCTCCTCGAGGTTTTTTCCAGCGGA
TCGACAGGATCTCGGGACCGGACGAATCGTCGGACTCTGACTGCGGCGCtgcctcctgcttctcctcgaacttCGCAGTCGTTGGGTCGGTTCGAGACGC
AGCTCGAGgccctcgccgtcgtccgcGGTTCCCCATGCGCCCTTGCGGATCAAACGCTGCAGTGCGCAATGCacggcgtctgcagccacGTACGCTGATT
GGTTTATAATCGGTAAAAATGACCATCACTCAACAAAAcattttcagccaatcgcaGAGTTTGCGCAAGCGTTGCAACCACAACGACGGTTCCGACTGGT
cgaacttccagcagctactgcagaGATTACGatgctcgagtcgctgcgcgTGTTCCTCGCGCTCGTGTGGTGGCACATCTGCCACTTCCTGGCGCACAAT
CTTCACGTACGGGGTCTCAAGCCTGCCAGTCAGTTCTTGCACAAGGTGGTGGTCATTGGCGATGACTTTGCAGCGGGGATTGGAGACTACATCACTGTGG
GCAGCGCTGGCGGAGGCGTCGCT