Description :
From Genome Similarity Track
Location :
Scaffold_115:26427- 28042
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_115-snap-gene-0.27Phosphatidylserine synthase

Sequence
1615 bases(100 bases per row)
ACAAGCCGCGTTAGTACGCCCACTGCGTTGTGAGCAGCAGCAGCGGCGTGAATGAGAGCCAGAAGAGCACATCGAGCTTGCCCCACGTGGCCACCTGGTA
GAGCTTGGCGGAGCTCTGACGCGGCGACGCCGAGTCCGCCGCGTGCTGGCGGCTCTGGTGCGAGAAGAAGCACACCATCCAGACGCCAAACATGCACAGG
AACGCGAGGATCGGAAGCGACACGAGCTGCGGCGGCGCGTCGCTAAAGAGCACGCCGTTCGCTGAGAACTTGACCCACACGAGCACCTCGAAGACCGCGA
TCGAGAGGATCATCCACGCGTTCTGGCCGAGCCGCACCGCCTCCGGGTTCGACAGGAACTCGTAGTACTCCGAGGCGCCCGGGATGCCGATGAGGAACAT
GAGCGACAGCCGGTACGCATTGAAGTTGCTCTCCTTCGGGATGCTCAGCGTATTGAGCAAGAAGAACGCGTTGAGCTCCACGAGCAGACACACCACGAGC
GCAAACATGATCTGCGCAAAGCGCTTGAAGCTCGAGAAGACCTCCCAGTGGTACTGGCTCCAGCTGATCGGCGTGAACTGCGAGAGCACGAGCAGCACGT
AGCCCATTTTCTTCTCCTTCTTGCCCGACCAGTCGTACTCCTTCGTCTCAAAGTACCAGAGCGTGAGGCGGCCCAAAAACATGCCGAGTAGGTTTGCACC
GAGCAGGTCCATGAAGAGCGAGTCCCACCAACACTCCTGGAAGTCCGGGATCACGAACTGAAGCGCGAGCTCGAGGAACTCGAACGCGATGCTGAGCACC
CAGCAGAAGCGCCAATCACGGAACATGCACATCTTGCCCCACCAGCCCGTTACGTGCGCCAGGAACCAGATGCTCGACACGCCGCGGTAGACCGTCTAAT
GAATGGAACGCTGCCAAGGGTTAGTGGCCATTGACGTGCCTCAGGGCTGAGAGTATCAGTGTTTACTTACATTCGCGTTGATGTCGCACTCGAGTTTGGC
GCCGGCGGGCGACTTCTTCAAGCTGCCGACCTCTGGGAACAGAAACTGCATCGACAGGATCGCGCCCTCGCGATTCTGTACCGACATGGCGGCCAGCAGC
AGCAGGTACACAACCGAGCAGCCGTGCACGACGCGCCAGAGACCCGGGTGCGGACGAACCTGTGGAAGTTTGTATCCACATTTGTATTAGCGACACGCAG
TCCAGTACGACAAGAGTCAAAAGCGGGCCCATTACGCACCATGAGCCCGTCGCGCGTCTGCAGAAAGCAATAGACGAGGAAGATCAGCACGCCCGTGGAG
AGCCCATTGCGCACGTTCTCCGCCACGTCCTAATCAAGCGATTGCAACAGCAGCAGCAGCAGCAGCAGAACAGATCAGTCATATGCATTACAGCAGAAGC
AGCAGCAGCATAACGACACCACCTGTGAGTCGTGCGTGAACGAGAAGTAGGACACGGCCGTGACCACGAGCGCGAGCACCGCCAGTTGGCGCGGCTGCTC
NNNNNNNNNNNNNNNNNNNNNNNNNNAAAGCAGCATGTTTTCCAGGTCGCTGCCTTTCGCGGCGCGGAACATGTTGTCGGATGAGAAGTTCTCTGGACGC
GGACTGTGGCCCGGC