Description :
From Genome Similarity Track
Location :
Scaffold_354:26427- 27761
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_354-fgenesh-gene-0.8Hypothetical leucine rich repeat protein

Sequence
1334 bases(100 bases per row)
ACACTGCTGGGTTGCGGTGAATGTAGGGCAAATTACTGGGCAGGTGCTTGATCTGCATACGCGCTCCCTGCTCCTCGTTGATTGTCACCACCCGCGGGTT
CACTGCTCCACTATCCGATGAGGAGCCACTTGCCTCCAGCAACTTGGACTCCATGCGCCTCGTGAGCACGGCCACCGAGCGCACTGAGTGCACCGAGCGG
ATGGACTTGCACTCCGAGAGCACGCTCGATGCCACGCTCACCATGTCGTCGTCATCATCATTGCCACTGCGACCGCCATTGCCACGATCGAAGCGCGCCA
AGTCGCTCGCATTCAATGGCACCGCTTTGTCGTCGCTGTTGCGCGCTTCCAGGCGCTCGTTGCGCTTCTCCTCGGCCTCCTCATACTCGACGATTGACTG
TATCTGCACGAGCTGCTGCTCAACCTGCGCCATACGGGCCTTGATCTCCACGTCGTCCATGAACTGGTCGATGTCCAGGTTGTTACAAAAGTCGATGAGG
TCGTCGGCCTCCTGGTCCTCGAGGCTCTCAAGCTTCTCGTCCGCCGACGCCTTGGTGAGCGCCCACATCGGCCGGCTCTGCTTACAGTTGCTACCGTCAC
CTCTCTTGTCATCCGAGTCGCTGTTACTGTTGTTGTTGTTGCGTACTGAGTCGCGGAACTTGGTTTCACGCTGTGAGAACCTGTTAAAAGGGAGTTCGTC
AATCAACGTGCTATGAGAGCCCTTAGAGCCCTGGGTAGACTAGACTAGGTCTAGACTTTGGGAAGCTATAGCTCCATAGGTCTGCTGTGTCGCACGACGC
ACCTGTCTTTCTTCTTCTGCTTGTCGGCCTCGTCGTCCGCGAGCGCCTCGAGCAGCCGCGTGCGCTCCTTCTGCAGGTCGTGGAGCCACTTCTTGTGCTT
GGAAAGCGCCGTGTTCTTCTTGTCGCGCTTGATGCCGTGCTGCGCAGGAGATCAGTACAGTGGAACAAAGAACACACACACAATACCGTTAGAGATCCAG
GTATGCATGCAACCAGCACAGACTCCTGGATGAACTTGTGTGTGCATGTTTTCAGTACCGCTGGCTCGCTCAGGATCGGCACGTTCATGCCGATGGGCTC
GCCCGGGTTGCCCGCGAGGAACGCGGCCTTGTAGCTGCTGCTCGCGTCGTTGTTGCTCACCACACGACTCTCCTTCGCCAGAGCTATTCATGACAAGCCG
CCAAATTGATCAGGGGGCACAGATACAAGGAAGATACAATAGCGTATGGCTCATAGACACTCACTGCTGCTGACGCCGTTGAACGGTCGGTTGCAGAGCA
TCACGCCCTTGTAGTTGCCGATGCTCACGGCTGC