Description :
From Genome Similarity Track
Location :
Scaffold_709:2642- 4530
Transcript NameFunction/comments
Pytar_ATCC12531snap-par_contig_709-abinit-gene-0.23ATP-dependent RNA helicase DHX8

Sequence
1888 bases(100 bases per row)
TTATGAAAGCTATTGCCGAGAATCAGGTGCTGGTCGTGATTGGCGAGACCGGTTCCGGTAAGACCACACAGATGACCCAGTACATGGCGGAGATGGGCAT
CACGTCCAAGGGAATAATTGGCTGTACGCAGCCGCGTCGTGTCGCAGCGTCGTCCGTGGCCAAGCGTGTCGCGGAAGAGTTTGGTTGTGAACTGGGTCAA
GAGGTCGGGTACGCGATGCGGTTCGAGGACTGCACGTCGCCCGAGACCGTGATTAAGTACATGACCGAGGGCATGCTCTTGCGAGAATACCTCGCCGACA
ACCGGCTCTCCAAGTACTCAGCATTGATGCTCGATGAAGCCCACGAACGCACGATCAACACGGACGTACTCTTTGGTCTGCTCAAGGAACTGGTCAAGAA
ACGCAAAGATCTCAAGCTCATTGTGACGTCGGCGACGCTCGATGCCGAGAAGTTTAGCAGCTACTTCTTTGACTGTCCGATCTTTACGATTCCGGGACGT
ACGTTTCCCGTCGAGATTCTGTACACTAAGGAGCCCGAACTCGACTACCTCGACGCGGCGCTCTTATGTGTGATGCAAATCCATCTCACCGAACCGGAGG
GCGACATTTTACTCTTTCTCACGGGCCAAGAAGAGATCGACACGGCGTGCGAAGTACTGTACCAACGAATCAAGACTTTACAAGAACGCGCGCTCGCCCC
CGAGCTCATTATTCTTCCAGTGTATGGTGCGTTACCGTCCGAGATGCAGTCGCGGATTTTCGAACCCGCACCAAAGGGGTCCCGCAAGTGTGTCGTCGCT
ACCAACATTGCCGAGGCCTCGCTCACGATCGACGGCATCTACTACGTTGTGGATCCGGGCTTTTGCAAGCAAAAGGCGTTCAACCCGAAGGTCGGCATGG
ACTCGCTCGTCGTGACGCCATGTTCGCAGGCGTCGGCACGGCAGCGCGCCGGTCGCGCTGGACGAACGGGTCCGGGCAAGTGCTATCGACTGTACACAGA
GAATGCCTACAAGAACGAAATGATGTCGACAACGATTCCGGAAATCCAGCGCGCGAATCTGAGCTCGACCGTGCTGCAGCTAAAAGCTATGGGCATCAAC
GATCTGCTGCGGTTTGACTTTATGGATCCGCCACCACAACAGTCGATGATCCTCGCACTCGAGAGCCTGTACGGGTTGGGCGCGCTGGATGATGAAGGGC
TCCTTACTCGCCTGGGCAAGAAGATGGCGGAGTTCCCGGTCGAACCGAAGAACGCCAAAGTTCTGCTCACGTCGGTCGTGCTCGGGTGTGCCGAAGAAGT
GCTCACGATCGTCGCGATGCTGTCGGTCGAGACCGTGTTCTTCCGTCCCAAGGAAAAGCAGGCCCAAGCCGACCAGAAGAAGGCCAAGTTCCATCAACCT
GAGGGCGACCACCTCACGTTGCTTGCGGTCTACGAAGCCTGGAAGAACTCCAAGTTCTCTAATCCGTGGTGTTTTGAGAACTTCATCCAGGCTCGCGCGA
TTCGACGCGCGCAGGACGTCCGCAAGCAGCTGCTGTCGATTCTGGATCGCTACAAGATGGACGTGACGTCGTGTGGGCGGAATCTGAACAAGGTGCGTCG
CGCGATCGTCGCTGGGTACTTTGCCAACACGGCCAAGAAAGATCCGCAGGAAGGCTACCGCACCATGGTCGAAGGCCAGCCCGTGTACATTCACCCGTCC
AGCGCTGTGTTCAACAAGAACCCCGAATGGGTCTTGTACCACGAACTCGTGCTCACGACGAAAGAGTACATGCGCAGCGTCATGACGATCGAAGCCAAGT
GGCTCGTGGAGCTTGCGCCAGCATTTTTCAAGAAAGGAGACCCCACCAAGCTGTCCAAGCGCAAGCGCAACGAAAAGATCGAGCCATT