Description :
From Genome Similarity Track
Location :
Scaffold_178:26419- 30125
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_178-snap-gene-0.15ATP-binding Cassette (ABC) Superfamily
Pytul_var.sporangiiferummaker-pug3_contig_178-snap-gene-0.16ATP-binding Cassette (ABC) superfamily

Sequence
3706 bases(100 bases per row)
CTGTACCGGTTCGCCATGCCGCGAGACTATGTCGTCCTTGCACTGGGTGTCGTTATGGCGGCAATCAATGGGTCGCTGTCCCCGTGCATGGCACTAGTTT
TCGGTAACGCGATCTCTGCGTTTGCACCTTTCGACAGCACGGCCGTGAACCAAGCAGCACTCGACTACTTTCTCATCGCCGTTGCGCTCTTCATCACCGA
TTATTTGTCGGCCGTCTTCTTCGCGAACTCCGCCGAGCGTCAAATGAAGGCTCTACGACAACATGTGTTCAAGCACTTGCTGCACTTGGATATCTCCTGG
TACGATACTCACGATGCGATGCAGCTCTCCAGTCGCGTCACGGGCGATACGATTCGCATCAAAAATGGCATGGGCCAGAAACTGGGCGATGCAGTAAAGT
TTGCAGGCTAGTTTCTCGGTGGGTACATCATTGGTTTCGTGAAAGGATGGGACATTGCGCTCGTGATGTGTTGCATCACGCCTGTAATGGTGGGCACGTT
GTCATTCATGCTCGGCTGGCTGCGAGTACGCGGACAACGAGCGCAGCAACTGTACGCCGAAGCTGGAGCGATCGCCGAGGAAGCGCTGGCATCCATGCGT
ACAGTGGCATCTTTGAATGGCGAGAAAGGTGTCCTCGCCAAATATAACGCCAAGACCGAGATCGTGGAGCGTGACAACATCGCGTTCTTTAAAAAAGCCT
CGTTCGTCCAAGGCGTTTACACTTGCAGTAATTGGCTCATGTACGCTGCAGGGCTCTGGTATGGTGGCAAGAAAGTGTACAACAACGAATCCACGCCCGG
CACGGTCTTCCAAGCGTTCTTCGGCATTTTGCTGGGCTCCATGTCACTCGGACAGATCTCACCCAATCTCTCGGCTGTTGCAGAAGCAAAAGGGTCTGCT
GAAGCTCTTTTTGCTATCCTTGATACAAAATCCTGCATCGACGCTTCTTCGGACACTGGAATCACCCCACGATCCTGTGCCGGTGCCATTCAAGCCGTAA
ACATCCATTTCGCGTATCCGAGTCGACCTGATGCGCAGATCCTCAACAACTATAGCGTCAAGATCTCTCCCGGTCAAAAGGTGGCATTCGTTGGTTCCAG
TGGCGGCGGAAAGAGTACGCTGGTCGCGCTCCTGGAACGCTTCTACGACCCAGTCAGCGGCGTCCTATATCTCGATGGCTACGACGTGAAGACGCTGAAC
GTGAAATGGCTGCGTGCTCAGATTGGACTTGTCTCACAGGAACCCGTACTGTTTTCATCGAACATTCTGCATAACATCGTTGGTGCTGCTCATAGTGGAA
ACGATACTGGCGTGAAAGAGCAGTACACTCGAGAGCAGGTTATCGCAGCAGCCAAGCTGGCCAATGCACACGACTTCATCATGTCGCTGCCGAAGCAGTA
CGAGACGTTGGTCGGTGAAAAGGGAGCCTTGCTCTCCGGTGGCCAAAAGCAGCGTGTCGCGATTGCTCGCGCTCTCTTGCGGGAACCGAAAATCCTCGTG
CTGGACGAGGCCACGAGCGCGCTGGATACCGAAAGCGAACGTGTCGTGCAAGCCGCGCTGAACGATCTCATGGAGAAGACCAACATGACCACCTTGGTGA
TCGCGCATCGACTGAGCACAACCCGCAATGCCGACAAGATCGTGGTTATCTCGTCAGGATGTGTGGTCGAGGAAGGCTCGCACGATGATCTGATGGCGAT
CCCAGACGGAGCGTATCGCAATTTGTACACGATCCAGCAGCAGGAAAGCACGAAGGATGACGACGCAGATGTGGGCATCACTGCTGCAGAATCCAATGAA
AGCTTCACTGAGGAGGCCACAGAAGTTTCTCATTTTGAACATGAACCACAACTGCGCCGATCGAGCTTCTTGTCGGTAATCAGCAACACCATGGTGGATA
ACAGTGCAACAGAACCCACGACGGAATCCAAGTTTACCATAGGATCAGCCATGGTGCTCAGCCATCCTGAACGCAGCTATTTCATCGCAGGACTGCTTGG
TGCAAGTCTTCATGGCCTTTCCATGCCGGCGTCGGCACTGCTCATCAGTGAGCTCTTGGCAGTCATGAATACCAAGTACGAAGCTTTCCAAGAGACCAAC
GAGCGAGCAGCGCTCACAGACCTGAAAGTCAACGTGACAACGTACGGCATCTGCTACGTCGCTGGCGCTGTCGCACTGATTTTCATCCACGGCACGCAGA
CATATGCTTTCCGCTTCATGGCAGAAAAGCTGACGTCGAGGCTATGAGATATCCATTTCTCATCATTGCTGCGACAAAATATCGGCTTTTTCGACGAACC
AGCAAACGCGACCGGCGCGCTGACCGCAAAACTTGCCACGGACGCGACGAAAGTGTCGCTCGTCTCCGGTGATTCCCAGGGCCGATTATTGCAGGCAGCC
ACCACGTTTCTCGCCGCTGTGCTCATTTCGTTCACCTCTGGTAGTTGGCTGCTCACCTTGATCATGCTTGTAGTGCTTCCGTTCCTTGTCATCGGTGAAG
TGATTCGGGGCAAGCAAATACGAGGTTCTGGTGGTCTATCCGATGAGCTTGAAGAGGTCGGTTCCCATGCGTCGGAGGCTCTGTACAACATTCGTACTGT
CGCCTCGCTTGGGCTTGAAAACCAACTCTGTGACGAATTCTCCGTGCTTCTAAACAAGCCACTCGCAAATGGACAGCGAGAAGCCAATATCAACGGCTTG
GCGCTCGGATTCAGTTCGTTCATATTGTTTGCCACGTACGCACTCGTCTTCTGGTACGGCGGCAAACTGGTGAGCAAGGACGATATCGAGTTCCGGCAGC
TGATCCGTACATTGATGGCAATTATGATGTCTGCACAAGGCATCGGGTTCGCCGCATCATGGCTGGGTGAATCGGATCACGCGTTCAAGGCCGGGTCTGC
CATCTTTTCGTTGAGGGATCGTGCCCGTCCCATTGATTCGTTTGACGAAAGTGGTGCTACACCAAATAAGCTGGAAGGGAGGCTGGAATTCAAGGACGTC
GCATTCAAGTACCCAACGCGGCCAAACGTCACGGTGCTCAAGCACTACAGCCTCGTCATCGAAGCAGGCCAAACGGTGGCTTTCTGTGGCCCCAGTGGTG
GCGGCAAAAGCACCATCATCTCGCTAATTGAACGCTTTTACGATCCAGTTCACGGTCAGGTTCTGCTTGATGGAGTGGACACGAAAACGCTGAATGTGGC
CTGGTTACGCCGTCAAATCGGGCTGGTCGGACAGGAACCAACACTGTTCATCGGGACGATTGGAGAGAATATCACATATGGTCTCGAGCAAAAACCTTCG
CAGCAACAAATCGAGACCGCCGCGAAGATGGCGAACGCGCACGACTTCATCACGCAGTTTCCAGACGGATACGACACACTGGTGGGGATGAAAGGCGAGC
AGTTGTCTGGCGGACAGAAGCAACGGATCGCAATCGCGCGCGCCATTTTGAGAAACCCCGCCATCTTGCTGCTTGATGAAGCCACCAGCGCCTTGGATTC
CGAGAGTGAGAAGACTGTGCAGGCAGCGCTGGACAAGGTTGTGGCGCTCCAACGACGGACCACCATCATCGTCGCACATCGCTTGTCCACGATTCGCCAC
GTCGACAAGATCTGCGTCGTGAGTGGAGGAAGGATCGCCGAGGAAGGAACCCACGAGGAGCTGGTGTGCCGGAACGGGATCTACACGCAGCTCGTGAACC
CGAATT