Description :
From Genome Similarity Track
Location :
Scaffold_77:264134- 266667
Transcript NameFunction/comments
Phyin_T30-4PITG_18966Putative uncharacterized protein

Sequence
2533 bases(100 bases per row)
CGCTGGTTATCCAGCGCTGTGTGCACCATCCGCAACTCAAGACTGTCAACTGGAACAACATGGTCATGTTCCGCTTGCGCAGTCCTCGAGGGTATGTGGT
CGCATACCAGACTATCAACCACCCAGCCTACGCCGAGGGATACACGGAGTATTTCACGGGTCACGAGGACATTGTGGCGGAGGATCTGCAGCCGAAGTTC
TCTCGCGTCAACACACTACAGTGGTTCCTCTTTGAGGAAGACGGCAACCTCGACTTTGACATGGATAGCGGAGGGTCTGACCTCGAGTTACTGGGCTCTA
GTGATAGTGAAGACTCGCCGAGTATTAAGAAGGAGTCCCTACCGAGAGGCAGAAGAGGTCTGTTTGCACCAACCCAACCTTATGCAGACTCCCAACGGCG
TGTTTCAGGTGGCGTCAAAGTATCATTTGGGGGCAAAGTGGACAACCGAGACACGTCTTTTGCCCGATTTTACATGTTCGAGGTGCTCACGTACATCATT
CGCTGGGAGAACGCGGTGGGCTCTGCTCGACTCACATTTTAAACGCCGTTGGCAATTAACTAACGTCGAGTAAATAAATTAATACAGTTAATGTCGTGGT
ATCAATTTGGTGCATGTACTTAAGTCGATGCACGAGGGTCCTCTCGCTAAGTATCGCCGAACCTGACGACGCGCTCAGAGTTGTAGCTCGACGTTCAAGT
GACGTCAGTCATCCCATCAGTTCATAGGCATCAACACTGGTCTGTCCAGGACAAATTGGATACTGAACTGGGTTCCGCAGTTCACTATCCAATTTCCCCC
TTCCTAAGCCTAGTGTTCTGATGGTGACTGCTGTATACGACATCGTGATCGTGGGTGCTGGTCTCATGGGCAGCGCTGCCGCCTATTACGCTGCGAAACA
AGGCAAAAGCGTGCTGGTGCTGGAGCAGTTCGAGCTGCTACACAGCAAAGGCTCCAGTCACGGCTCCAGCCGAATCTTCCGCGTGGCGTATCCGAATGAC
ATTTACACGAAGATGAGTCTCCAGTCCCTCAAAATCAGCAGGACATGTGAGATGCTATCCTGCTACTGTGAGATGCTACTTGCTACGGTCTGCCAGTGTC
CAGTGCCAGACGTCATTGCCACAGCCCAAGACACTGGCAATACCAGTACTACCGATCCAACCTACAATCCTACGCGTGTCTATGCATGTACTGCATCCCG
GCGTACCGGTCTGCAACGCGCTCACGTGCGAGCGGCGTGCCGAAGATATTAAGGACTGTATGAAGGACGACATTGGTTACCAATTTGGTGGCGGTGAGCA
ACTGCAACTGCGTTGCAGGTGATGGTGAACTACTTAGCTTTCTATAGACTATCTTAGACTGAGTATGTGCTAATCTAACTATGCGGAACATGGAGGTTCA
GGTGCTGGCAGCTCTCACTCTCACAACTGCTTTTGCTGTGCTGCGTGCACAACGAGTGAGAGGCAGCAAGCACCAGAACTCCGTGGTCCTGTCGTGGTAC
TTTGCCCGGCACTCACGTGTCTTACATTCTATTCCTACTTGCTCTACACCTACTGCCCTACAAGTCTGTGCTTATGGATGAATATCATCATTTCTCCGAC
CATACTTGAATAAAATATTAGTATTAATGTCCAATCAGAAAGGATAGCCCGTATTTGGACGAATCATACATCGACTGTGCCAATATTTTGACTAATCAAA
GCACGGTAGGGTCAGTATAGGTCGATAAGAGGCAGCTCCGACATATCGGGTCGGAGGCCCCTCTTGTGTTATTGATATCGGCATACAAACCTCCACTCAT
TAGCATATTTTGCAAATAGCACGCGAGCTCCGACCCCTCCGACGCAAGATGAGTCTGAGCGACCTCGCACCGACAAACACGAAGCGCGCACGGGATGGCG
CGGCACGCATGTTCAAAGCGTTTCTTGAGGAAGAAGGGGTGACATGGGAGTACCTAGAGGTGTGCATGAAGCGCGACAACGCTCCCCGCGTTTTGGAGGC
CGTGGTGGACAAGTTTGGAATGCATCTCGCTTTCAAGGAAGGACGGAAGGGCAGCCTGTTGGCTAGGCACTCAGTCATGCAGTACTACCGACAGGCAAAG
AACTGGTTGCTCGATCAGTTCCCACAGCATCGAGAGGCTGTCGGCAAGGTTCTCCTGAAGAAGGGTCAAGTGCTGGAGCGCTATTGCATGAAGCGAAAGT
CAGGCAATTTTGTGAAGAAGGCACCTGCATGCACGAAGAAAGCACTCAAGCCGATGATGGTGTACCTCTATTCAAATGGTGTAACAGCTTCGGACTACCA
AGACGCGGCGCTGCTGTGCTTGCTCTGGTTTCTGTTTGGCCGAGCCTCTGACATCTCGCTACTCCGGAAGGTGACCTTATCCATCGGTTCGGGGGGAATA
TTTTTCCTGAGGCTGATCCGTGTACAGACGTCCGAAGAACAAGGTCTCTCCCTTTTTTCCGACGACGACTTCGCCACGTGTCCGCTGCTAGCTATCGCTG
TGGCTCTTGCAACTCAATCGGCACCGGCGGCTG