Description :
From Genome Similarity Track
Location :
Scaffold_347:26404- 29365
Transcript NameFunction/comments
Phypl_g7259hypothetical protein

Sequence
2961 bases(100 bases per row)
CCCCGCGGCACACCGCGCGGCTGGACGACCCGACCCACATGCACTTTCTGGGGAGACCCCCAGCATATTCGATGCCGGGCATGCTTCCGATGAATGCTCC
AAACCTGGAGCCAGCCTCAATCCCCAACCGCCATCATCAACGGCACATGCTGGAGAGAGTCCCAACACTCATGACGCCGGGTATGCCTCCGAAGCGTGCT
gcacgaacggcagcttcCAGCCGCTCAAGCGATCAACGGTCAACCATCGCTTTCCCCCTAGATTTGCTGCACACGCGGTCGGCGCTTCCccggcggtgct
gcggcCAATGACCCCCCCTTGACGCGACTAACTCTTCGAGTCCGAACTGCCCCCGTTGTGAGCTTAACTGTCCCTGCAAGCTTCGATGTCCAACTTCATA
CGCCGTACACGCATGCCACTACCGCAGTTCGGGGAGCTAGTCCGATGTCAAACACCGGACGTCTGCAGCCCGAACAAGGCCATGATGCCAAAACCCATGC
GCCGACAGTGCCATGGCTACGAGCACgtcgatgagctcgtccgcAAAGCATCCGAAGGCATTCACGTACACCTCTCAGCGCCACTGCCGACGCAGTTCGC
ATTCCCCCGCAATCATCCGTCCGCCTTCCGTCGGATGAACGTCTTGCGCACCAACACTCGCAAGGAACCAGACGTGCTTCGGTGCGTTGTCGTCGATGCA
GACATCATCCACATTTTGCCCGAGGAGGTGTTTGTCATCCCCTTCGGTGTCGTCGAGAAAGGCGACGGTGACCCACCAGGAGGGTCTTCCACGACCTATC
CTTCTTCGACGATACGTCTGACAACTCACACACAGACCAAGAGGAAGTACCTAACGCGTCCTTCTAGCCACGTGCCAGCATCGCACAAGACAGCACCCGA
TGTCGCCACGCTAACTCCGATCACGACGCGAAATGGTCCCTGGCCACATGCATTCGATCCGCTCAAGCTtttcttcagcgccttctcgacgGGGAGCGCA
CCCTGCCCTGGGAACGACTGTACCGCGTGTCGGAGGCCATGCACAAGGACCGCCTATGGTGGTTGTAACGCGGCTGGTAGTACCGTCATGGTCTTACACT
GGtgttgcaagaggaagctcggaatagCAAACCCAAGTGTATGGGATTTGGGGCAAATATAACTCTGTTTTCGTTTAGGCTCANCACGCGCTAGCCGCGT
GCTtttgtacctacttatgtaaatCGTACCTACCTAGTTATGTAAtaacttggatgtggcccgtCACAGTGGTGGTACATCCTCCACACTCCCACCATGA
ATGGTGTTCCGCTTGAATACTTCGATGCCAATCCGCAGCGAGACTTCATAATTATCACGGACGCATCTGAGATCCTTGAGGCGTTCGCTTACGTACGAAC
CCCCCTCCCCTCGGTACGGGCTCTTATTCAGATGTCAATCAAGGCTTGGCGAAAGAGTTCTACATCAACTACCGCGAACTGTTGGTGTGCGCATTTGCAG
CCCAgccgtggacgccgctgTTCAGCAGATACCACCCCGAGTCCAATACGATTCACGTCATTCGACAACACTACAGCCGTCTCATGGTAGACCAAGAtga
cgtcgcgcagcactCGTACCCAGCTACTAATCCTGCTCCTCAGCTCATGGGAGGTCAAATTCGGGCTCCGCTTCTCGGTCTCACACATATTCGGTATCGA
GAACGTCATCGCGGACGCCGGGTCCCGCCGATTTGAGGACAGCGCTCACTACCAGTTGTTCATCGAGCCAACGGTCGGGTGGTCCCGTACACTGCCCTCG
TCAGGCATATCACCCCTCGAGACAACATCTCCGCGAGCACTCTGTTGCAAACACCTCCTACAAGAAGTACACGAGGGCGTTCAATTACTAGAAGTGGTGG
ACCTCTCGCCCCGGAATTCCCTGGCGACTCGAGCTCCCAGTTGCCGAACAGATCCGACCCATATCCGGCTTTATCTCGCCACGGACTCGGCTCCCAGCGG
GCCCTACCGTTAAGGCAGCTCTAAGCGGCATCAATCACTTCATGCTAGCAACTGCCCTCCAATTTCCAGCAGACTATCCACACGTCCGCATGCTCCTGAA
GGAAGTTGGCCGGCGCGACGCGCCATCACGACAGAAGGCCCCTGTGTCAGTGGCGCTTCTCGAGACGTGTTACCATACTCTCGACATCCACTACCCGCAG
ACCAAGAATCTGTGTATGTCCTTCTTCGTGCTCCAGCGGCCCGATATTGTGGCCACCACAGTATAGGTCTTCTGCTGGTTTGCTCTCAAGGCAGCTGACC
TTACAGTTGTCGACGCGCTCGGCAACCCCATAGCAGATCCCAGTGCCGCCACGGCAGCATGTATCCAGTTGCGCGGCTCGAAGATAAACCAAGGCGGCGC
GCCCGTCACTCGCATGCTGGCCCGCTCGGGACACCCGTTATAATGCCCCGTCCTCGGAACACTACTGCTCCTCTTCTCAAGAGAGAACCTGCCTACTGTG
ACGCCCGCTGCCATGTTTATGATCCAACGGCATACGTTGCTGTATCTCGGAGGCGACGTAGCGAGGACGCTCTGAGACGTGGCACGCACGAGAGGTGAGG
ACCCGCACCAGTACAACGTGCACTCGCTCAGGTCTGTCGGAGCCACCAATATGTATCGAGCAGGTGTTGACGCGCTCACTATTCAATTCCACGGTCGATG
GGCATCGGACGCTTTCATGGTGTACACCCGATTGTGAAGTGGGTCGGTCTCCTCGGTGGCAGCGAGAATGGTGAGCGGATCTAGAGATTCGACAACGCTA
CAATGACGGGTGTGATCTATCTCCCTATCTTTGGGGGCGCAACCCGTTCCTACGCTTGGGCTGTAGCGCGGTAGCCACACCCCTAGCTGTAACCCGTTAA
ATTGACCCCAAGTTCTGTGCGCGGTGTTCATGTGGAAACCACGTTTTTTGCCCCTGGTCCC