Description :
From Genome Similarity Track
Location :
Scaffold_3167:264- 2566
Sequence
2302 bases(100 bases per row)
GGGCAATAGAAGAGCAAGTTCATTCAGATCCCCTGCGTAATCCGTAGCGATAATCCTGTAGGGATTTAGTATCCTCCCCGACTCAGGTCTTCGTACATCC
CCCCATCAGATACTTCCTTTAGTCCCCAAGATCCCACGCTTCCTCGTTCTGTGCTTTGAGGATCCCGCTCAATACGGACTCCCTTCACAAATGTTCCCTC
GATAATCTGGGGGCTGGATCCAATCCTTCCTCTGGACCTAGTGACGGCCATCACCTGGACTGTTCTTTTCCTGGATCCAACCACCACCACTTCGTCTAGT
CGGTTCAACGTAACGAGATCCTGATGCCCGGCTTCTCTCTCCCACTTCGACACCGCATTGATTCCGTAAAGCGGCACTAGCCAAGCTGTCTGCACTGGCA
TTCCAATCTCGCTTGACATGCACCAACTCGTGATTCAACCATCCACGCAGGTGGATCATCACTTTCTGCCGTAACAGTGTTAGGGCCGGGGCCTTGCAGT
CAATCTCGCCTCGCACCTGTCTGATTACCAAATTTGAATCCCCACAAATCACCAGCCTTTTTGGATCTTGTCCCTTTAGTAAATCCAAACCCAGAAGGAG
TCCGTTATACTCCGCCTCATTGACGGTGAGGCCTTCTGCGTAAGTGGATCTGGCTCGTACAACTTCCCATCCGGGCTGTCTCCACAGTATTGCACTGTAT
GCTCCTCCTCCGCGTCGTACACGAGCGGGTCCATCGAAACTCAGGACGTATAGATCCTCATCCACCTGTACCGTCGGGATCGGGATCTGGATCCGGCGTT
TGGGCTCTTTCTTAGGGGCGATCCTAGTCAGTCGCTGGCATAAACTATTACCGTAGGCTGACGTTCCGGATCGAAGTGACGGAGGATAGGCGTGGTCGCG
ATTCTGTTCCTCAGTTCCACGAATGCGTGTTGAGCTCGGATCCACCGAGATTCTGCCTGTTCCATGTTCTGATCCGTCGTCTCTATCCAGCCTGGATCCT
CTCTCTGTTGGTCCCGGGGTGGATCCAGCTCCTGTTTCAGGTCCTCTTCTGGCGTCCTACCACTTGGATCCCTTCGTGGATCCGGCATCTCCTGGGCTAA
TGCTTGTTGGATTTTCATCTGGACAGCTGGAGTGGTCATCGCGGCAAAATCTACCTCTCTCAATTCGTACAATACCGCTGCAAACAGGGCGTAATCCTTG
ATGAACCGACTGTAGTAGTTCAAACTGCCCAAGAAAGATTGCATCGCCCGTAACGACTGTGGGAAAGACAAATCGGCTAACGAAGGCAGGTCCTTAGGAT
TTGCCTTCAATCCCTCCTTGGAAACTCGATGGCCTAAGTACTCCACCTTGCGCATCCCCCAATAGCTCTTTACCACACTAATAGAGAGATTCCACTTAGT
ACACGCCTCCAGTAAGGACGTCACTCTCTCGCACAACTGATCCCACGATTCCGCCGGGATCTGAATGTCGTCGATGTAAGATCTGCGTCCTAACACAGAT
GGGGTCCCAGGATCCCCTGGCTCCCCCGCTTCGAATGGATCCACTTCCGTATGGCCTTCCCCAGACCCACCTGTTTTAGACTCTGGTATTCGGGTGAATC
CATAGAGGGCGTTATCGATCAGGCGTTGGTAGATCTGGGGTGCGTTCTTCAATCCGAACGGCATCCGGTTCCACTCGAACAGGCCAAACGGTGTGATGAA
TGCGGATATTGCGCGAGCTCGATCCGTCATAGTAACCACCCAGAAACCACTGGCCATGTCTAGAGAACAGTACCAGAGTACTTTATCCAGATCTTCCAAC
AGCTCGTTGAATAGGGGCATCGGATACACCATCAATCGAGTCAGACCGTTAACCAGCCGGTAATCAATGCACAGACGTATATCCACCCCGTTCTTCTTGA
TGATGATTACCACTGGGGATGCCCACGGGGACGTCGAGAAACTGATGATCCTGGCTTGCAGCAGGCCCTTAATCAGGTCCGATAGTTTTTCTCGGAACTG
AGGTGCCACCTTCCGCACCCTTTGAGCGATCGGTTTCGCGTTGCCGACATCGATGTCACATTTGACTCCGCGGGCAGCGGGCGGTAATGCATTACCTTTA
CCAATCAGCAGGTGTCGGCTTTCCCAGATCTTCCGACGTAGCCGATCCACTTCCGCGGGTTCGTTCGCCCCCGGATCCACTTGGATATCATCAATCGTGA
CTTCTTCTGTGGTCAGTGGTACCTCCGGGATCACCGCCATGCCTTCTCCCAGATCCTCGGCGTGTAGATCCCCGCCATACGGTAACAGACTTGCTCATCT
TC