Description :
From Genome Similarity Track
Location :
Scaffold_1239:264- 2130
Transcript NameFunction/comments
g15663.t1hypothetical protein

Sequence
1866 bases(100 bases per row)
TTCATCAACCGAAGCGTAGTCCACGTGGGAGGGCGCATTCGCCTGCTTAAAGTACTCAATCCACTGTTCTTCTCCGACGAGATGAGGAGCGAGGTTGAAT
TCGTAACGCGCCACCATGCGCTTCGTCTTCGACTCGATGCACGCACCGACGGGCATTGCGAAGGCGCCACCCCACTGCGTCTGGAGGGCGTTAATTGCGG
TCAGATACGTCTCGTAATGACGCATGAAGTCTCTTCGATCTTGCATTGTCCTGCCTGCGAACCGCGGGGGCTGCCGGAGCGCCGGTGCTGCAGCCACACG
CTGTCCACCGGACACGGGGCTGACCGTCGGCATGGCCTCGTCGGCCTCGGAGCCATCTGCTGGATCGAAGGGGTTTGGGATCTGAAGCCTCAGGCCGGGA
GACTGCGGCGCCGGCGACGCGGCACTCTCCAACCGCATCGCTGCCGTGCGGGCTGCGAGCTCGTCGATGTCCGTCTGATTACGACCCTGCGAGGGTGGTT
GAACCACGGCGTCATCTTCGCTTGGTTCCATGTTCACGCGCTGGACCGGCGCAGAGTTCGAATCTGCGATCGAACTAAATTAACTTTGATGTATTGTGCG
GCTCTCTGCCGAACCGCTTGCTCTCTGCTGAGCAAGTTCCAAACTGTCTTTGCTTTTTATGGTTTGTCTTTCTTTTTCTAGCTACCTCTCCTATGGGAAA
GTTGCAGATCTGAATCGGCCGTCTGGACCTCTAGGCGATCACAGTTGCGAACCTGGACCTCCAGCTGTCGGGTGCTAGATGCAGGCACCCGGACAGATCA
ATTACACAGCAAAACGTCGGATACCCACACGAGTTCTGTGTCCACAGGTTAGATATTGACATGAATCATGTCTTCTGGGGATGCGAGGCTGCAGAGACAT
TGAGAGAAAAAAATCCTCGCAGACTAGGACTTCGAGAACGAGTCGCTGAACGGGCCATACTTGTAATGGGTCTGCTTAGACCCACTACTTAAGCTTACAC
GTGTGCGCACGTGTAGGAGGAAGCGTAGGAGTAATTTACTTAAGTTCTGTATACTTGTATCCACAAGTATACTTAAACCTAGATAAAAGAACCAAACGGA
AGCTTTGGTGGTAAATGAGAACTGTATTGATTGTAAATGGGGTTTCCTCCTAAAACTGATATTTCTAATGAGAGGTTCTGCCATTGGATGGCTGGCAGAA
CCCCTATCTATTGAATGACTCTCATTGGTAGAAAGGTGTTACTTTCTACCAGTCATATGCCTTTTGCTATGAATGTGGACCACCCTGTGGTGGTCACCTG
AATGTATGCCTTAGTGCATGTTGCACTAAGGTAGGAGGTGAACCGAATGTGTAGCCCCGCTACACCATCCCCCCGTTAGGATTTGACGTGCCGGTCTCGA
CACGTGAATCCGTATTTTCTTCGGGAGAACACGTGCTCATTCCCAATGAGCACGCCAACGACGTCTTCGTCCAAGACGCCGGCCGCTTCGGCAACAGCAA
GTGCTGTCGTCGCCTCCAAGGCGACGACGGCCGCTGCCTCAGCCACGACCGCTACTGGCATCGCCTCGACGGCGATGCCGACAAGCGCGGCAACAGAGAG
TTGCCTCTCTGTTGCTGGATACCACTCGAGGTGGCATGAGAAACATGCCATCCGAAACAAGACAGGCAAGATCATTGCTGTCGAAAACGGAGTGGGCATC
TACTCTCCGGGTGGAGAGGGAGTTCCCCTCGACTACGGAAGCGAAGTCGAGGAGGGGGAACTCGAAGGAGACAAGGACATCTTGTCTCCGGGCCACACTG
ACCCCAATGTGGGTCTGCGTCGTCCACGCGAGGACGACCCGAACGCTTCGAGCTCGAAGCGTTCGC