Description :
From Genome Similarity Track
Location :
Scaffold_3730:264- 1595
Sequence
1331 bases(100 bases per row)
CGCGCTTCCAGCATGGATGCCCCGGAGGGTCCTAAAGTCATGCGTCGTGGTTCGGACGACGTGTCTGACTCATCCTCAGCGGCGGATTCGTAGTTCGAGG
ACGCAGCTTGGCTGATCCTCGGCGAGGACACCGGATCCATAGTGCGCGACCTTTCTCCGGTGATGGACTTAACTCTGGCAGAGAGGTCCCGCGTCGCGGA
TACTATGAGATCCAGGTCTAGCTCCAAGATATCCTCTGCGTCGAACACACCAGCTACGATGCCTGACTCCGTAAGCAAACGTAATAGATCTTTGACTGCC
ACCAACGTGTTCGCCGTTTTCGTTGGTGCTCTCACCGGATCCCTTGGATCTTCGATCTGTCGTGATTCAGGATCGGCATGACAGAATCTTGATGCAGGAA
GTCGCGTAACGCTTGGTGGCGATACACAAACTCGAGATCCTTGTCGGACCAGCTTGACCTGGATCCAGCTTGGTCTTCTTCCGACTCTGGAGCTTGCATC
TTCTTCCGCGTAGTCTTACTCGTTTTCGTTTTCTTTCTTGTTTCTTCGACTAGCGGGCTTGGGTTTAGGTACGGTGTTGGCTTAACCGGTGCATCTGCAA
ATGCATACCGTTTCGCCTTCACTTTCCCTTGTTTTGTTAGCGGATCTTGACTTGCGTCAAGATCCGCAGGGGTCCCCGAGGGGACCTGGGGAGGATAGAG
AGGTTTCTCTTCTAGATCCGGATCCGGATCCACCTCTCTTCCGTCGACAGAGTTCCTCCCAAAACTCCATCGATCCGCGGATCTTGTTTCATTCAGCAGC
GTCTTCGTCGATCCGACCTCCGACGACGCCTCTTCCCCTGGCTCAATCTTCACTTGAGCATCTTCTTGGGACTCACGGTGAAATCCCGAGTCACCAAAAG
ATCCGGGCACGCGCACCATTGTGGTGTAGCGGGATCAGCAAAATCTGCGAGATTGCCAGATCCAACTTACCAACTGCGCCCAGACACCGACTAACGGAGG
GGGTCCCCCGATGATCCGTGTTCTGCTGAACTTTCCTCACCTTGTGTACCCGTCGGTAGGGCGGGATCTGCTCTATCGGTAACTTCCGAAGAGTTCAAGT
GGTGAAGCTTGAGTGTCTTGGCGAGACGTGGGAATGGGGTGGAGCAGCAGTGAAAATCTTCACTCTGCGTCCGTGGATGGTTCCGTATCCTAAGCGAATA
TTCGAGCTTATGGATCCGGGGCCTAGATCGTGGATCTGGCCGTAGGGTTGCCTTGCGGGTGTGTTCCCTTGCCTTTGCGTTCCTTTGCGTTGTACTTGCC
GCCTCCTGTGACGGGATCTTGAGAGTTGAGA