Description :
From Genome Similarity Track
Location :
scaffold_30:26398- 27449
Sequence
1051 bases(100 bases per row)
GGTACCAAATATTGTGTTGCACGGTACTGGCCCCTACCAAAGGAGCAGTGGGACGTCATTAACGCTTTCTTTGGAGCGAACTACAAGCAGTGGggagaaa
aaaaaatcttaactGGTTCCACCTATCGGTGGCAGCGGGACCAATGGCTCGTGGCAAATTGTGCATTCTTTAATAAACACAATGTAGCTTCGATTCCGAT
GGAATCGAAGACTTCTAGAATGGGTATGCTGCAAAGCAGCAAACCGGCTGCACCCGCTCGGTGTTCTCGACTTGGTGATTGCAAATTTTCACTACACATA
AGAAGAAGCGACATCCCTCTTACTGCATTAAATACTCAATCGGAGTAGGTGAGCATGACACATGGACCGTCTAGTGCATCAGCGCGTTCGATCGTCGCCA
GACGCAGCCTTTTAGGCCATACCGTGGTGATTCACACATCTTCTGACGGCATATTCGGTTAAGTCGTGTTGAGTACGGTACATTAGATGCAAAGAAACAC
ATTCCACACGTGGGTACATGCGCATTACATTGACATTTGTCAATATGACAAGTGGGCTTTGGCATCGCCAAATCCTGGGTGGAATACATTGAATGAAAAG
CTCCGCGGACACAATTCGTGAGGTAAAGGTGAAATCCACTGTAGATTGGTCAGTGCAGATGCACTTGGGTAACTGCCTAGACCGGCAGATTAATTGGCCA
AATACAGAGCAAACTATACCGGCATGACCCCCCCCAAGAATCAATTTTAAGAGGATGGAAAACTCTGTGCGGAAAGCTTTCAAAGGTTTCAAAGACTCCT
CACGCATATTCTGATTTCATAGCGACCGTTCTACGTTGTTTGCGATGCTTCGCGCTTTGCAATAGGCTGAGCTATACTCCAAGTTGATATCAATGGGTAT
GGATGCGTAATCGTGATAGACTCTCGCCAGTTCTCAGCTGACCAGGAAAACTACCCTGTTTATCACAAGCGCCACATCTATGAAATATACCCCGGTCAAG
CTCAAAATGACCCTGATTAGCTCCAGTTATCATTGCTTACCATGCGTCATT