Description :
From Genome Similarity Track
Location :
scaffold_243:26396- 36657
Transcript NameFunction/comments
Pl_107144kinesin heavy chain, putative
Pl_107145hypothetical protein PHYSODRAFT_545625
Pl_107146hypothetical protein PHYSODRAFT_302460
Pl_107147hypothetical protein PHYSODRAFT_302462
Pl_107148hypothetical protein PHYSODRAFT_286439

Sequence
10261 bases(100 bases per row)
TTTCTTGTAGTGACTCTATCTGAGTGTCATTTTCACTACGGCAGTTAGCCAACTCCTTTGTGAGGTCATCAACGCGCTGCTTGCAATTTTTCAGTTCCAG
CGTCTTAGCGGTGAGCTGCTGGCGGAGAAGCTCGTTTTCTAGAACTGAGCTAGTAGCACGTGAACGGTCCACCATCACTGGCACTGAAGATGCGATGACT
ACTTCTGAATCCATCTCTTTAAAATTCATCTCACCGTCTTCATTAATCTTTCCCGGTATCAACATACCACTATCCACCGCTTTTGCTGTTGACACCGGAG
GTGCCTCGGCAGTGTTAGCATGTTTTTGACGCCTCGCTAGCATTTGATTCAGCTCGTCGCATTCCTTTGCCTTTGCCTCCAGTTCATTTTCCAGGAATGC
TAGCCTTTTCTTGAAATCTTCGTTTCTGCTAATGATTGAAGAGACATCTCGCTCTTTTTGCTCGAGATCCTTGTTTTTCCCCTCTAACTCGATACACCGC
TCTTCCAGACTGGAGAACTCTGCTGTCTTGGATGCTTGTTCGTCTTCCAGTTCCTCCACTTTTGTCGCAAAAAATTTCAACTTTTCTTCTAATGTAGACA
CTACAGGTTCATCTAAGTCATCCCTTTTGGATTCGCGGAGGAGGGCTTCCAAATTGGCAATACGTTTCTCCTTTTCAGCGACAAGAATCTTGTATTCTGC
CACGGTTCGTTCTTCGTTAACCTTTGGCTTATTCTTGATGCTCTTTGCACGTGTGCCGAATCGTAGAGTGGATATCGTCTCTTCGCTGTTATAGCTACTT
GAGCTAGCACATACTAGAAGAGTCGTCTCGGAATTACCTCCAAGTGAGTCTTGCAATAGTCGAGTCAATTTGGAGTCACGATATGGAATGTGCGTATTGG
CATTTCCACTTGTCAAAGCGTTCATAACACTTCCCAACGCACTAAGCGATTTATTAATGTGTTGTGCCTCTTTGAGTGTCTGTCCTCGAGCATGAGTCTT
CCCCACTTTCTCCGACCCTGCCAAGTCCACTAAGAACAACTTTCCACTCTTCAAGGAGCCTGTGGTCGTATTTCGTTGCTCAATAGTAATGATGAAGACA
GAGTGGCTTCGACTGGATTCGTTGTTCATCCGTGTTGATGAAATGACTCGGTTTGCTCCACCCAGTCGCATCACAGATTGCATCTCTTCCACTGAAGCAC
AACAAACCTCCGTTGCACCCGCAATCCACACGCCTCGGTCACGACTCTCACGCACATTTAAATTCGTCGAAGAAGGTTTTAGTAGATCGCGAATTTTCTC
CATGTAAATCTCAACGTACGACACTCGCACGATAAATTCGAGATCCGCCTGCATGTTCTGGATGCCGTCGAAGATGTCGCTCATGACGCGGGGGATGATA
CCCTCGTAGTCCTTATCTCCTGGCACGCCTTCCATTGAGAAGGTTTTGCCCGACCCCGTCTGGCCGTAGACGAAGCATGTGCAGTTGTAGCCACGCAGAG
CGGACTCCACCAACGGCTTGGCCGTCGCTTCGTACACGTGCAACTGCGAAGATTTCGTGCCGAACACTTGATCGAAGGTAAAACTGTGATTATCCGACAC
GCCGCGTGCCTCGCTGTGCACATGGGCAGCTGTGTCGTCTTCTAGACGCACACACTCGACGGATTGGTGTTTCTGCTCGAGTTTGTTCTGCGGCCGGAAG
CGCGCGCACACGCGAATACCTGCGCGGGTTTCCGCAGCAGATCCCATCAGCAAAAGAAATCGTCAACTCAGAGGATGGATAGCTACATAATCTGATAATC
TGATTCCTTCTGATTCTTTATCAGTCGAACCGTACTGATTGGCATCCAACCGAAGCACACTACAAGTACAATGTACTGCTGACGGCAATGGAGCAACATC
CTGTTGCTAAGGATAGGGTAGTTGCGTATGCTTGTTCTAGCTACAGCCTCTCGCTGCGTTAAGAAATCACGCACTATTCGCAAAAATTGGGTTTTGTCCT
TGAGACCGATATCGACAATACACAAACCACGTTGTGGTTGCAACACTCGACTGTGGTTGCAATCCTCGACTGTTCTTTGGAGCTCCAAGACGATGGAATC
AATTCACCTAAAGCGATAGGTTTTTGCTTGTCCGAAAATCTCCTCTTGTCGATGAGTAAGCCTGAATAGCCACAAACCAAGCGTGTCGCTCGGGATCAAC
AAACACGTCCAATTGCTCTTCATTTCGGAAGATATGCACCGACGGATATACACATGCATATCGGAGGTGTTTATCTAGTTGCCTTACACTTCCTCTGTGT
GAAAATGGCAACACCACCAGAATCTCCAGCATTCATCTGCATTATTACTTATCTACTGTCTCTAAACAGCTCATTACGATAATACGTCTGCTTCTTCCCA
TCCCGTATCCTTGTGCTCAACTCCGCAGCTTGTATTCACTATTGCTGGAGGTGAAGGGCCAAGAACTAAGGTGACCATCGTCTATGCGCCCATGCATCTC
TACTTTTGCGAATTTCGGTCTCGAAAATCGGAAATCGTCGCTGCCAAACGTGGGGTCTCGAGCGCATACTGGTGGTCTCCCATTCGTAGCCTGGAAGCGC
CCCCCAGAAGTCAGGAAGATGATGTCCAAGCTGAGCCTCGTGCGTCAGCCGCTCACCCGCGCGCAGTCGTCGGTGGCGGCCGCCGTGTCCAACTACCCAT
CGTACGTGCTGAACGCGCCTGCCACCGAGGTGACGACGCTGCCCAGTGGTCTGCGTGTGGCCTCCGAGGGCTCGCACGGCGAGACGGCCACTGTGGGCGT
GTGGATCGGCGCTGGCTCCCGCTACGAGACAGCAAAGAACAACGGCGCCGCCCACTTCCTGGAGCACATGGCGTTTAAGGGCACGAGCAAGCGTACGCAG
CAGCAACTGGAGCTCGAGATTGAGAACATGGGTGGCCACCTGAACGCCTACACGAGCCGTGAGCAGACCGTGTACTACGCCAAGGTCTTCAAGAAGGACG
TGCCTCGTGCTATGGACATCCTCAGTGACATCCTGCAGAACTCGAAGCTGGATGAGGCTGCCATCGAGCGTGAGCGTGATGTCATCTTGCGTGAGATGGA
GGAAGTTAACAAGCAGCAGGAAGAGGTTGTGTTCGACCGCCTGCACGAAACTGCTTTCATGGGCAACGGTCTCGGCCGCACCATTCTAGGACCCATTGAG
AACGTACGTCGGGAAGATTGCAGTGTGCTATGAATGTTGGACTGACTGTTATGATTTATCTTGATGCGACTCTAGATCCGCAACCTCAAGAAGTCGGACC
TGCAGGACTACATTGCCACGCACTACACGGCCCCGCGCATGGTGATTGCCGGTGCTGGTGCTGTAGACCACTCACAGCTGGTGGAGCTGGCCCAGAAGTC
GTTCGGTGACCTGCCCACTACCCCCGCTGTGGCCCCCACGCTTGAGCCTGTGCGTTTCGTCGGATCGGATGTCCGCGTTAAGGACGACAGCATGCCTCTG
GCCCACGTTGCCATTGCGTTCGAGGGCTTCAGTTGGACCAGCGAGCACTCGTTCCCCCTGCTGATCATGCAGACGCTGCTCGGCAGCTGGGACCGCACCT
CAGGTGCTGGCATGAACATGTCGTCTAAGTTGGGACAGGTGGTCGCTGAGAAGGAGCTTGCTCACTCGTACATGTCTTTCAACACGTGCTACCAGGACAC
CGGTCTGTTCGGTGTGTACGCTGTCGCTGACAAGTACAAGTTGAACGACCTGACTTGGTACACGATGGAGGCGCTGGTGCGCCTTGTGCATAAGACCACT
GACGAGGAGGTTGAGCGTGCCAAGACGCAGCTGAAGGCCAACATGCTGATGCAGCTCGATGGCTCGTCGCCTATCTGCGAAGACATTGGTCGTCAAATGC
TGACGTACGGTCGCCGCATGACCCCCGCAGAGATCTTTGCTCGCATTGACGCTGTGGATGCCGCTGCTGTCCGCAAGACGGCTGACGAGGTCATCAACGA
CAAGGAACACGCCCTGGCTGCTACTGGCCCTATCCACGAGCTGCCGGACTACAACTTCATCCGTCGTCGCTCGTACTGGCTGCGATACTAAGCGGATCGT
GTCGCCCCTACATCCCGACGTCGTCAAGAAGGCATAGAGGCTGAAACGAGATAGGTAAGTTTTCTGTATGGGAAAGCGGACGGGCCGTACGCCACTTTAC
CACAGGGGAGAAGCGTAAACGAATGAAAAGAAAAATAAATCGACTACAAACGCAGTGTCTTCGTGCCCTCGAGTGGTTATTAGCTCGATTGATGCCGATG
GTAAATGGCAGAATTTGCCGCTGTGAGTTTAACGTGGTGAACGTTTCCCCAAAAGCTGTGATTCGTGCGCGAGTTAAAGTAATACCAGGCCCCGAATCCA
GCGTCAAAGACCTTTTCGAGGTTGCCAAGTTTGAGGTCTTGCATGAATACTCTCAAAGCTCGTTGTCGGAACATGATTTGAATAACCTTCGCAGCTGCAT
TTAGTGTAGTGTCGATGTTTGTGGTGGGGTTTACAAGAGTTGCTGTTGACTTTTGGTTGGCGTCAAGTGAATAATGACAGCGATGCAACAACAACGGAGC
CTCCCACTGACTTAGGCCGGTGATGCGGTTGTAGTAGAAATATTGGTTGTTATCAGGGCTTAACACGCGCTGGTAAGTTTTCGCTAGCAGACCAACGAGT
TGGCGACGCGCTCGGAATGCTCGAAAGGCGCACTGAATTACGACTGCCGCTACTGACAAAAACTTCCTCGATTTTGACTTTTGTTGATCTGGCAGCTTTG
AGTGCTGGTCTTCGTCATGTCCAGACTTCTGTGCCGTTTTTCCAAACTCATATTGCGCACCAGGAGCAATAAAATGACTAGGCCCACCTCCCAGTTCTGC
GATTCTCTCGGGACCTGAGCTATTCATCTGATGAATTTTTCGGTCCAAATCACGAAGCTTGTACTGAATCTGAGAAGAGTGATCTCTATCAGGATGTGAC
ACAAGTGTCTGTCGCGGTGCTCTTTCACGAAGGAAACTTGCACAACGCTCATCTGAATCGATTTCTGCCAAAAGAATCGTTTCCGTTGCTTCAAATGTCA
AAATGGTATCATCGGAGCTCGAGACTCGTCGTTGCAGTGTGCTTCGAAAGTCATATCCCTGTTGCGGCTTCAAAGCTCCGTTCCACGTTCGACGGGGATA
TATTTTTCGTAGCACTGGTGGGCTTAACTTTTGAGAAGATAATGCAGTAGGTCTTAGAACAATATTAGGCAGCAGACTCTCTTCACTGTCCACATCACAA
GCCCATCTTTTGGCTTTTGAGCAATTTTTTGCGGCGTTGTGGGCAATACGGTGCTTGCACGATAAATGTGTCTTTTGATTGTCATCGCTTTTTCCTGTCT
TGCTTACTGGAAATACTTCTGGTGTGATGTTGGCATACCGGTCACACTTCTGAGGTCGATGCTGGTCATGCTTCAGAATACTTAAATTCAACAAAGGAAG
TCCTTCCGACGCGCTTGAAGTATTCGCTTCACTAATCTTTAACGACAGTGTATCCTGGTCGAGTAGAATCGTTGTGTTCTGATCGCATTCCTTCATGTCA
GAAGAATTCTCGCAGTCCCTGCTCCAGGGTGCGGTCCCGAGCTTCTGGTTCACGAATGTATTGGAATCGTATCGTACTGATCCGAAATTCTCACAGATTT
ATCGTTTTTCACCGACGCTCGTCCATAAATATTATTTACCACCAGGCCGACCGAAATAATGTCTGGTGTGTATAAGGTCTTTCCTCAAGTTGATCTGGGT
AGGTTGGATAAATGTCGCCGCAAGAATTTCATCATGGAAGCAAGCACCTGCAGTTGTAAGTATGGTTTGTCGTTATCGTTCAAGATTTTGGTGGAATGTA
TGTACGGATGTTACCGACTATATCAATTTCGCTTGATTAGTTCGTGGGTTGACACAGCAATTTGTTGTAGTTATCGGAAGTCACACAAATGGGCAAATTC
AATTCCAAATACTTCGTTTTACTGACCTCTATTCCTTAAGTTGCTTTAATAATAGATAGTTTACCTGCTTTTAGCAACATTCCGTTTTGTCCAAAGCCAT
TCGAGGAGTGGAAGCGTCATGGCTGGGGCCACATGCGTGTTCGACGAGGATTCGTCTGGACAGGAGACCCCCGTGGGGTTCCGCGACTCACCAGGGCAAT
GGCATACCGCCAATCACCGCAAGCGTGCCGCGTTGTCGCAACTGCAGGGAGAACCAACGCAACGCGATAGCCAGGCGACACAAGTAACAACGGAAGCGTT
GACGGAAGTGGCAACCCAGCCTCAGGAGGATCTCGCACCAGTGTTTGTCGCTGCTACACCCTATCAAGAGGAAATCCTTGATGGAGATGAAGAAGAGACG
CAGATTCGCATGACAAACTCCGAGGAACAGGACGGTGAGAGAAAATGTTGAGTGATTTTGAGTGGTATGGTGTGACTATGGGAATATTTCTTGAGTTTAG
GAGCACCGAAGCCGGAACGAAAGATATTTGAGGAGGCAGTGCCGCTACCGATAGCGTCTGTAGCAAGTGGAACAGGTCGATCCTGTAGTAGCGCTGCGAT
GGGACAGAGTGATGATGATGCGGATTCGGACATGTCGGACGACATGTTGGAGCAGGATGGTTCTGTTGCTGGACTGTCTTCGATTGCTGCTTCTTTTCAA
AACAGAGAGAAAGAACTGGAAGTTGTGAAGAAAAGAATCTATAAGCCTCGCACCCCGTTTCGAGCGTCTCCACCCCTTTCAACTCGTGACGATTCGGATA
GTAGTGGTGGGGAGACAGAGATCGAGGGTGAACCGAAAGAGGAATCGCCTGCAAAAAGGTATGTAGCAGCGAATAATGAAAAATCTTTATCGAAGGACAG
ATTGGCACTGCGTCTAACCAAGAGTGCCAGCTACTCGAAGGCAACTGTAAAAGATTTCATCTGCACTAGACGCAAAAAGCGCAAAAAGCATACGACGATC
GCTATCGACGCCAGAGAAGACACAAAGCAGTTCCAAGCGGAACCACAGTGAGCCTGGTGAAGGTAGCTACGCGAAGGCAAAACGGCTTCGACACAGTGAA
GCTAAAATATCTTCACACAGTATGGAGCACGGAACTTCGTTGGAGAAGCAGAATGTACCGGAGAAATGCAACGACGACACTCCAAAATCTCCGGCCGCTG
AAGTTGCCGTGATCGATGAAGAGTCTACGTCGCTCCATTCGACACCTCGTTCCCAGCGCAAGGTACTTGCGTCCAGTCGTGGCAGGAAGCGAGCGGTAAG
CAGTCGATCAGTCACAGAAAGCGAATCGGCGAACTCACAAGCAGAAGGTGGATCTATCCGCATCATTCTGACGGGACTGGAGCCCACCCCTGCAATCCGG
AAAAAGATTAAGTCAATCGCTGGCGCTGTCTACGAGAGCAACATCGAGAAGGCCACACATGTGGTTGCTCCTCAAAACCAGTTGAAGCGGACAGTGAAAC
TGCTGTGTGGTATATCGTGCTGCACGCATATTCTAGGGGAACGCTGGCTAGACGAGTCCGCACGGATCGGCGTGGCGGCCGATGAGCAAGCGAACTGCCT
GCACAACGAGGAGGCGGAAGACAAGTGGCAGTTCGATCTGAGAAACACTATGTATGGCGTGCCCGTGGGGCAGCGCCAGCGTCTGTTTGCCGATTATAGC
GTATTTATCACGAACCACAAGTCCGTGCTGCCACCGGTGAGAGACCTGGTGAAGATCGTCGAGTGTGCGGGTGGCAAGGCGTCGTCCAAAGGAAAGCCTG
GGACTAATGACTTGGTTATCTCAAGTGAAGCAGCGCTGGGCACGGCGTCCGTGCGGAAGGCATTGACACACGCGAATCCGCAGCGGATCTACTCTGCCGA
GTTGATTCTCAGCAGTATTCTGCAGCAGTGCGTGCATCTGAATAAGCATCGCCTGGAACTCCCTGTCATCGGCAAGACGTGGGCCACTAAGCGCCAGAAA
TAACGTGCGGCTGAATGCTCGTTGTTGCAACGCTTGTGTATTACAATAATAAGTTGATGTCGCTCGTGCAATTGCACTTCTATGAAGTGATGAGCGAATA
ATAATACTGGTACATGAAGCTGTGATGTCCGTGTCGGAGTGCCTACTTGGCAGTCTGGCGGAGACCGAGGAGAGCGCAGCCCAGCAGCGAGATGACGCAC
ATGGAAAGCAGATGCTGACGCGCCACGGTCTCTTCGATCCACTTGTCGACACTGCTGATGCGTCTTCGCGTCAAGCGGCTGAGTGTGACCTCGCTAGGAA
CGTCGCAGTAGCACACGGGCGCGTCGTTGGGGCAGAACTCGCGCTCTAGCACGAGGTGCTCACCACGCTGGTCAGCGAATGAGAGCGTCTTCTTGGGCGA
CGCCGAGTAGCTGACAGTGATCATCTTGGTCGTGGACAGTTCGTCCAGGCGTGAGCCACACGAGGCGCCACCACACGTGAACGCGCTCTCCTTGCGCAGA
CACGAGCGACTGCGCTGTTTACGCGGCGTAGGCGGCTGGTAGTAGTGATGATGGCGGCTGCTTGAACCGTACGGGTACTTTTGCCCGATAGTCATCGGCT
GCTGCATTTGCAGCGGGCGGAGGCAGCCAACGCTGCAACTTGATCGCGATGAAGTCATGTGTCTGGCACTGCGTTTTCGCAAATGAGCGCAAGACACTGA
AAAAAAAACTGATGACGACGGTCTGTGGTGGATGGCTTTTCGGGCAGCTACTGCCACAATATGGACTTACTTGTCGTTTGTAAGCCAGAATTGTTTGGCC
TTTTTCTACGGACATGGCAGGGAGGGGTGAAAACAAGAATGTGGTTTAGGCTGCGAGGACTGTGTAAGGATCGAAATGCAAAGGTAGGCAGTAGGGAAGT
AAGTGTAATACGGCTATTTGCGTAGCTACATCGCTCACGGGTTTACATCCAGAATTTGATGTAAGATTCTGTCAGCTCTCCGGTTAACAGCTTGTTGCGG
CACTAGATTTCATGACATCCGTCCTTCAGTCTGTATCAATAGCGCAACAAAAAAGCCGGGGACAATAGACGGGGCGAAGATCGAATACTCACATGTTGCT
GTCTGGCCTTCAGTGGTCTTCCTCCGCAGCGAGAGCTCTCGTCCTAGAGCCCCTAGCATGGACGCCGAGTACGTCCAAACTGAAATCCTCGCGCGTTGCA
AAGTCTCGACTCGAATGAACTAGGCGGTGCTGCATCTTAGCCTAATAAATTCGGCGGTACACAGCCGCGCACTTGAAGCAAGCCTATACTTTAATCAAGT
GAGATCTCCGAAAGGCGTTATTTCATTGTGTCAACGGCAACTTGACTTGTACATGTGAGTTCCGGGTCAAACGCGAAATATGTGAGTTTGGCAATCGCTT
TGTGCTGGCAGCGTCAGCGTGACACTAGTATACCCTCGCTGGCTCACATTGCGGTGTCGTGTGACTTGTCGGGTGTCGCGCGGTCAAAGCATTGTGCGTG
GGATTTCATCAGCTCATCGGCTGCTTCATCTTGGGGCGTTTGCCAACACGTATGTACCTTGTTATATCATCAGAGTTGATTCAGGCTTTGAACGCCATGT
TTGCGGCGTTCAAAACTTTAGTCCAGGCGAAGTTTTCATTAGTTAGTCTTATCTGCGTCGGCGACTACCGCCACTCGACTGTTCGAGGCGGTTCTTGTCA
AAGTCGATGTGCTGCTGCAAGATGCCACTCAAAATGAGCTCAGCGGAGTAGATCCGTTGCGGATTCGCCTGTGTCAGTGCCTTCCGAACCGAGGCCGTGG
CTAGTGCTGATTCAGTCGTGATCACCAAGTCGTTCGGACCGGCACTGCCCTTAATCACGGCCACCCCACCGGCGCACTCAACGATCTTCGCCAGGTCTTT
CATTGGTGGTAGCACGGATTTGTGGTTGGTGATGAAAACTTGGTGGCCAGCGAATAATTGCTGTCGCTGCTCCAGCGTAAAGGCATACATGGTTTTCCCC
AGATCAAACTGCCACTTAGCTTCTGCCTTCGCATCTTTTAAACAGTGCGCTCGCTCATAGATCGGAGAGCACACACGAGCCGATTCATCGAGCCATCGCA
CGTCCAAGACGTGTGTACAGCATGAGATCCCACAAAGCAACTTTACCGTTCGTTTCAGTTGGTTCTTCGGGGCGAGAATGTGCGTTGCCTTCTCAACGTC
TTCTTCGTAGACAGCACCAGCTATCGAATCGATCTTCTTTCTGATTGCAGCTGTGGGCTCA