Description :
From Genome Similarity Track
Location :
Scaffold_316:26382- 28787
Sequence
2405 bases(100 bases per row)
GGTAGACCGTGGAGTCGAAATACCGTGTCAATGAAGATACGGGCACAGCCCTGTGCTGTGATCGTCTCTTAAACTGCATCAAGATTTACCATCTTGCTGA
AACGGTCAACTAACACAAGAATACCATTATTCTTGTGTGCGGCTTTGGGAAACCCGAATACGAAGTCCATTGAAATGGACTGCCAGTACGCTGCTAGATT
GGGAGAGGATGTAGTGGTGCACGGGATGAAGGATTAGGTTTCACCCGTTAACACACCTCGAAAGCACGAATATACTTGCGTACGATATGGTACTGGCAGG
GCCAGTAACAGTCGCGACTAACGGTGAGGTGAGTCTTTTCCCCACCAATATGCTCACCTTTTGGCGCATCGTGAGACTCATAAATGATGTGCAATCGCAT
ATCGTTATGAGTGAGAAAGACGAAGCGAGGAGTATCGCCGGCAACGGCTGTGTAATACGGCAACCCGTTGCGTATTGGGTATCGATCTGCGGATGCTCAA
TACAGGGCAGGTAAATCTTTGAGCGATTTACGAGATGGACACCAGATGATCCATCAGTCGCAGAAGAGCCTTAGCTTCTACGTAGGCCTTCTTTATGTCT
TCAGCCGGTGTTGACGACAAAACACTAGCGATTAGTATTACAACAGTGGGATTAATCCCACTGTTGGTTTGCGCAGCCGAATCGAAATTCGGTCGGCGTG
ACAACGCATCAGCGACGACATTGAGTCGTCCTGGCTTATATTGCTATACTACGCGAAGAAGGACAGCCATCTCGACATACTTTAAGAGTGGTGTTGACTG
TTTACGGCCGTGCGTAATAACGTAAGGTCCGTATAGACTACACACGGTCTACCTCCTAGGGGATAGTCGCGAAATATAGCCAGTGCATATTTCATGGCAA
GAAATTCCTTGTCACGCAGTGAGTAATTGCGCTTGGCTGCTTGCAGCTGACGCGACTGATAGCAGACGGAACATTACGCACCTTCTGCACCGTACTACAA
TAATGCGCAGCCGCTTGCGAAGTCACTGGCGTCACAGACTTGTGGAATGGTCTGTCTTGATCTGCAATCTCCAAAACTGGTGATCGTATCAAGATCCGCT
CGATACCTTCGAAGGAGCGCTGAAATCAGCAGTCTATACCCATTTCCCTTTTTTTCTAATTCAATTAACGAGAGAGATGAACAGTCACCTCGGCGTAATT
GTGCGAGTATTTGATGCAAATACGTCGCTAGGCCAAGGAAATTTCGAAGTCCCTTGACATATGTAGGCACCGGCCAGTCGGTGATCGCTTTGATCTTTTC
AGGATCGGTTCGGACGCCATGCTTGCCCATGATGCACCCAAGAAGTGGTATTTCGCTAGCAGCAAATATACACCTTTTGAGGTTTGCGTATAACTTATAC
TCACGCATTAGCGTAAGAACTTTCCGGACGTGGAGTCGGTGCACTTCCACATCCGTCTTTCCATCCATAGCCCGGCTATGGACGAACACATCATCGAAGT
AGCTGGGCGCGAGCTCTCTTACGGATCTTAATAGATTCATTACACATCTATTGAATGTGGCAGGTACATTACTTAGCCCTTGTGGCATTACTAACCACTC
CCAATGAATACCACTTTAGGTGCTCACTGCAGTACAGGGAATGTCTCTTTCCGGCATAAGGATCTGATAGAACCTATCCATCAGATCCATGGATGAAAAG
ATGGTACTCTTATCCATACCATCTATGATGACACCTTTCCCTTGGTATTGGTGTTTGAGCCGGTAAAGTGGCAGCATTCATCTTGTTGAAGGCGTGTACT
ATCCGCCAATCTCCAATGGACTTTCGCACACAAAAGTTCGGAGAGTCTTGGTGGAGAGGTTGACCGTCTCGCATGACCCGCTGCTGAACGATCGGTAAAG
AGTTTGTCGACCGCTAGTACTTATTTACGGGGCATTGGCAACTGCTTCATACTTCGACCCCCGTTTTCAGGCCGATTGCGTGACGAGTACCCTTATCCTT
AGGTAACTCGCACGGCACTACTTCTGGGGAAGCATCCCTAGGTTCAATCTAATCATCGTAAAAAGGATTTGCCCAGAGAGATTCCCACGACTGAGATTTA
TATATCTCTTAATTCGTGTCTTCTCACCAAAGAAACTCTCGTCCATTCATGAGCTGCTGAGAACCCTTCATTCTCGGCAAAGAACATTGCCGACCAGATA
TCGGTGACATACTCGTCCTGTGGAACGAGTACGCAGATCGGCTTGATTTTCCTCTACGAAGATCATGCAAGAACCTCTTCTGTCCTAGGGTGGGCATTGA
GTGATCTCCGAAGTTGACTTCGGAGGCGCGATTAGATCAAGTTTCTAGATATCACCTATACTTGATCCGTCATTACCAGGCCATTCAATGTCTATGTTGT
CTTCT