Description :
From Genome Similarity Track
Location :
Scaffold_38:26381- 27674
Transcript NameFunction/comments
Phymu_g2185hypothetical protein

Sequence
1293 bases(100 bases per row)
ACTCATTCGATCCCAAAGCTGTATGGTGCTTGATCGACTCCCACTGGAAAGCAGAAAGCGACTGTCTTGGGACCACGCGAGACAATCTGCTGGCCCCTCG
AGACTCTGCAGCACATGAAGAGCTTCCGACACCAGCTAAATACCATAAACTTCAGTCAACAGCCAACAGAAAAGCAAATTTCTACCAGACTAACTCACCT
GTGGTGTCTGAGTATACCCCAGTGCTTCCTCCTTCCACTTGATTTCCCACAATACGACCGACCCGTCACTTGACGCTGAGGCTAAAATTTCTCCATCGGG
AGAGAACGCCAGCTCCCACACGTCGTTCTTGTGCAGTAGAAGCACTTCGATGCAGTCGGCTGTCACTTTGCCAGTCATCACGGGCATTGGCACTTGCAAC
TCCATTTCCAGTCCGTCCTGCACCAATTTCTATAAAAAACACATTAGAAACGATCAGATTTTCCTGAATGTTTAACCATTTTCCCACTAACCCGAAGAGC
TCCTTCTGGAATGATTTCGTCTGGGCTAACGAGCCCCTCGAGCTTCAGTTGCAGCTCATCGTCCTGCCAGGGCATCGTCGCTCTCTGTTTCATCTCCTCT
GCGTCTCTACACAGCAAAAGCTCTGCCAGTTGCTTCACTTCCGCCTCACTGGGCTGAAACACGGGCAGAATCTCCTCCTGGAAGGTCCGTAGCGCCTCTG
GAAGCTGTTTATTCAGTAGAAAATCCACGTATTTCCTCTGAAGTAGCAGCAATGCCGCCTCCCTAGAGGCTCGAGGCGACTGCATCGTCAATTCATTCGT
CTGTGTCACGAGTTGCAGCGCCTGATCCCATTGGCGACTGGCAACGAGactttgcagcttcttcatggcaTCGGAGCGCAACTGGACGGAGGCCTCGCgc
tccaaagcagcagcggcgtcacgGCAGCCCAAGTCGTAGAGttctcgcagcagcagacgcgCCCACTTCTGGCGCTTGTGCGGCGGGGAACTGGCGCCGG
GAGACAGCGAGCGCTTCACCTCAGGGTCGTCCATGGCTTCAACCTGATGTGAAATTTTCAGAAAGAAACAAAGTTGTACACCTAATAAGGGGTTCGATTT
TGACATTAGAGAAAATACACTAATAAAGGTGAAGCATTTCTAAGCTCTTGCTTGTTGAAGAGGACCGTCGCAAGCACTCGTGCACTTACTTACAGCATAA
CCACCAGTTCTTCTGGTTGCACTTATCCACTGACAGTGCCAGTGTCGGATTACAGCGAACAAACGCACTTGCAGTTCAAACGGCAAAACGCGC