Description :
From Genome Similarity Track
Location :
Scaffold_2051:2638- 4104
Transcript NameFunction/comments
Phypl_g14607hypothetical protein

Sequence
1466 bases(100 bases per row)
GTAGTCAGGTTGCTGTTTAAAAACCCGAACGAATACTCTCGTGTGTGATTACCTCTGCGAATAGTTTACAACGACGTGATCCAATTGTTTTTTCCGGCGC
ACAAGTTCTATGTCTGAATGCAGTTTTCGATGCTAATCGGTGTAAAGCCATTCGTTcctctgcttctgcttcttggccttcttctccgctgTGATTTTCT
TCCAGTCAAtgtgcttgcgcttcagTTGCTCCTTCCTGCGTTGTGCTTCTTCGCGGTTTTTCTCTAGCTCGGTCATGTCAAAGAAGTGGCTCATTTGCCG
CCCCGCACGATCTGGTGCGATGCCCGCCTGTTGCCAATATGCGTCACCCCCGAGTTGCTCGTACTTGCCTGTGAGCCGATTAAACTTGGCCCGAGCGACG
TAGTTCACACCCGAAACGGTCTTCTGACTTGCACCGATCGAATCGGACTCGGGGACTTCAGGTGGAATCCAGTCGGTCAACTACACAAACAGCGTACAAG
ACGAGAACTTAAGCATCCAACCACTTTCGTGCATGCATCTCGTGCCAGATAACGTCCTCTGGAAACTTACCCCGGAGACAATAGCCGCCTCTGGCTTGGT
CCACTGCGTTACCCCCGTGACCACATTGTGGTAGTAGTATCGCTGCGTCTGTGCGTCGATGTGTTGCTGCCAATCCGCTTTTGCTGTCCgaacagcatca
gcagccgTCTCCCCATCCACAGTAGCTGCCGCAGAAGGAGCGCTGCTATCAATGCCGCTCAAAATGGCGTTCAGTTTGCTGAGGTTGCCCGACGGGTCCA
GCACTCGCTGCGTCATCCGCGCCAGGCGTTCCGTGTGCACCCGGTTAAGATGAGCCTGATACTCAACGGAAACCTGGGGACCCGCCGGGACTGCTGGTGG
CTCATCGAAGCCCTCAGGCTGCTCCCACTGCGTCTTCCCCGTGCTGGCATTGTAGTAGTACGGCTTGTTGCTGGCAGcgtccacgtacttggccCACTGC
CGAGGCTtaacaccagcagcgccgacctCTGTACGCTCCTCTGTTTGTTTATCATTGCTCCCAGCCTTGTCACATCGAgactcgtcctcctccttcttaT
CCCCTTGAGGCTCCtgatcagcagcttcggtCTCCTCTGTcgcctcttcttcttgctgctctgctgcttcctgccCCTCGGGCTCCTGTTCCTCCTCCCC
TTGGTCCTCACTCTCCTGCTCCGGCTCGTAGTCTCCGGGTTTGTCCCATCGACTGGTGCCGCTCGCTTCGTCGAAGTAGTAGGTGGTTCCggactcgtcg
tccacgaactcgcgCCACTTCGGGGCCTTGTCCTGGCTCGCGTCTTGCGCGCGCGGAGACTTGAAGCCGGCAGGGACCTCCCATGATGACTCGCCTGAGT
GGGCGTTGTAGTAGTACGCCGAGCCGGAGGCCTCGTCCACGTGTTTTGCCCACTTGCCGCCGGTGT