Description :
From Genome Similarity Track
Location :
Scaffold_3:263793- 271991
Transcript NameFunction/comments
Physo_127864reverse transcriptase
Physo_110826Os01g0724500
Physo_127866hypothetical protein

Sequence
8198 bases(100 bases per row)
ACCATGGCATGCCGATCGACATTGTGTCGGATCGAGACCCGCGCTTCACTGCACACCTTTGGCAAGAAGTGTTTACGCTTCTTGGGAGTCAACTTTCGAT
ATCGACTGCGGACCATCCGCAGACGGACGGGCAGACCGAGCGCGTGAACCGCGTACTCGTAGACGTGCTTAAGAGCTACGCTCACTCGTTCCAACACTGG
AGCGAGTGCCTGCCGATGGCAGAGTTCGCCATCAACAACTCGGTGCATGCCTCGACCGGGCATACACCATTCTACGTGAATGCCATCAGGCACCCACGCC
TCCCGAGTCTATTCGGGATGTTGGCTCCTTCCTTAAGTGGGGGAGGATCTACGACGGCAACACAGCAGCCGCAGAATGCCGCTGACACTTGCACAGTGTC
AGCCGCGACTACGCGCGAGAAGAAGAAGAAGCACGCGTCTGTGCAGGGCACAGACGCCGACAAGACGAACGCAGAGGCCGGGCCTACTGCTAGAAACGAG
CTGAACGAGTTCAGCTCGGACGCAATCAACTTCGTGCAGCGCAGTCAAGCCGTCATTCGGTTTGTCCAAGACGCTATCGCAGCTTCTGTCGACCGACAGA
AGCTGAACGCAGACAATGTTGGCAGGGGCAACACAAATGAATTCAAAAATGGTTCATTGGTTTGGTTAGCAACTCAAAACCTGCCTAAACATGCCGTTTC
CGACTTCGGGGCGAGCAAGCTCGCTCCGCGCTTCATCGGGCCGTTCACGGTGTTGGCACGGCATGGCAACGCCTACACGCTAGATATTCCATCTAGCATG
CGCCTCCATCCGACCTTTTACGTCGGGCGGCTGAAGCCATACCGGCAGCACGAGCCACCTAGCTCAGCTGGCCCGAAGCGGAAGCCCCAGCGGGAGCGAA
CCTCTGCTCCAGCGCGTGAACGCGTTGGGCCAAGCGTGCGACGCGACCTCCCACGTCGACAGAGATGTCCTACGCGGTCTGCGAGGCCTGAGCGACTTGA
GCCCTCAGGATCGCCACCTCCTGCTTCAGAGCGGCGAACTCCTGGCTCTGATGCTGCTCCACAGCAGCGACCCGCTCCTCGAGCGTCGGGCCATGGTCAA
CCCCAGGTTGACCATACCCGGGGCGTGTTCCCACCACCGCCGCCTCCGATCCGCGACGCCCGCGGCTCAACACGCTGGATTGTTGAGCGTATTGTGAACC
ATAGTATCCCGAAAACGAACCGGCAGCCGGTTCGTTATCGTATTCGTTGGAGAGGGTTTCCGCCCCACCAAGATACATGGGAGCCACGGGACGTCCTGCT
GCAGGACGTTTCGGAAATGGTGGGGGCGTACGAAGCTCACCACGCACTGCCGACGCGAAGGTAGTGCGAGCGCTATGGTCACCTACAGCGCCCGAGGTCC
CACGATCGTCGCGTTCCTCAGGTGCCAAGAACTTGGCACGGAGATCCTTGAGACTCGCAGGTACATGAATCGTCGTGTACCCGTTTAGGTCGCGGTCGCT
CAAGCGCGCCGCACCCGGAAGACACAACGTGCACTGTTGGCCTTCGGGCACAGCGCATGGAATACCAGCGTCCACAGAGGATCTGTGGAGCTGCTCCAGC
CGTCCGCGCGTCGAGAATGTCTCGAAGCGCTCACGGGCATTCTTAACCCGCTCACGGTAAGCAGCCGGCTTCTTGTTGAAGTTCTCAACAAAAGCATTCC
AACTTTGACAAAGTGCCTGCCACTCAGGCACTTTGCTGCGAGAAGAGGTCTTCTTGCTGGAGAAGTATCGGAGATCGTGGAAGAGCCCGATGTAATAATC
GCGCCTTTGATTCGTTAAAGGATCAAAGTGCTGCTCCTCCGCAACAGCATCGTCGTGGATACCGCTGCATCCGTACAGCGGGATTTCGTTTGGAGGCACA
GTGTTGGCCACACGGTCTGCGATCTCTGACGCAGACGGCATCCACGGATCGCGCGCTGCTCAGGCAGCGCGCGGAGAGCTTGAAGGCGCCACCTCACGCG
GGGAGCTTAAAGCCCCAGCAGCAAAGAGCGGAGTGTCGCTCTCGCCGCGCGAATGCTTCGAGCTCGAAGCGTCCGAGTCGTCTCCTTCACGAGGGCGTCT
CGACCCGGCATGCAGGTCGAGACTATCGCTGTCGATAGACTCCTTGCGCTTGCTAGAAGAGGCCTCACCCTCTTCCATCTCCACGTCGTCGTTCTCGAAG
TCAACGGCGTCGTTGACTACAGAAGAACTTTCGAGGACAATCTCTGGTTGAGTTGTCCCCGCCGCAGCCTTGGTAGCAAGAGCGTCACGCTTTGCTTTGA
GACGCTCGCGGTACTCGGGGATAGAGAGAGTTTCTATCTCGGCGGAGGATCCCCCCTGCTGCAGCGTCGGTCTACTTCTGAGGCGAGCTCATTGCGGAAT
GAGCTCGAGTTTTCTTTCTCCCAACGTGAAGAATTGACGAATGGTCAATTTCCTGATTGACGTGCCGTGACTCGGTGCGTCTAACCTTGAGGGGGGATGG
TGTAACAGGGTTACACGCACAAGTGGCTACAGTCACTTGTAACTCTAACAGACACGACGTCTGTTAGAGGTTCGAAAGACTTTCTCGACCTTGGTGTAGA
CACACCAAAGGCTACATACATTTACGACCACCACGACGGGTGGTCCATAGAGACTTAGGATTCCTATTGGCTGAGAGCAGCATCTCTTAGCCAATGAGCG
ACATGCATAGCATTGAAATTCTGCCAACCAGCCGTTGGCAGATTCCTATCTTAGAATATTACATTTAGAGGAAGTCAAAAACATAAAACAAAAATAGCAG
TTCTCATTTTTAACCCAAAAACATTATTTGGATCGTTTATTTAGATTAATCTATACTCGGAGGCCCGAGTATAATTAACTCTAATTTAAACTAGGCTACG
CTTCCTCACATACACGCGCACACGTGTAAGCTAAAGTAGTGGGCCAAAGTAGGCCCATTACATACGTACGCTGATTTACTGCACGAGTTCTGTCGAGTTT
CTCTTAAATTCTTAACGCAGTCGTTCTTTTTGCTTGAACTTCATTCGGGTTATTGGTTAACGGCATCTCTGATGGTGAGGCACCTTTTTTACTGGACAAT
TCATCAGAACGGACGAATTCGATACACTCGTTTAGTGTGCGCCACAAATACGATGCTGGCCGATTTCTTCGGTGCTGAGAAAGGCCTCAGCTCTTAGTAT
TTTCGTCCTCATGTTGCATTTGCTCTTCACCGTACTGCTACCACGCCACATTTCTCTCTACTCCGGCTACACGACACGATGTTCTGGCGCAGATGCGTGT
GCACAACGCTGTGTGGGTTTTTGCTGAAAGCTCTGGTAACGGTTGGGCTCGGCATTATGCACGTGAACGGAAAACTAAGTCCGAACAGATCGCCAGAAGA
AAGACACAAAGTGGCTTGTTGGGCACGGTGGCAAGCGACTCCGGGATCTCTGGTTTGCTCCCACTGTTGACCAACGGCAGTTGCTGATGGAGCAGACACC
CGACAGTTCTTTTGCTGTGGACACGGATGGAGTTTGCGACGAGCGCAACCCCCCCAGAGCAGTGTTGCCTCCTATTCAAAGGCCAGCCAAGCCTCGATCT
ACCAAGGCGAACATCCGCTCGCCGACGTTCAAGCGCAAGGGTTCCGCCTCCACCTCGAAAAAGGCAACGAAGTCGCGAGCTAAGAAGGTGACAGTAAATT
TGACGGCGGTCACACGTGAAATCACAAAGTTTGAGAAGAAGCTGTCGCATGTGATGTCGACGCCGCTGTAAGAAAAGCTTTATGGCGCCGATCAGATTCT
CACATGGATTGTTGGTGGACGCATATCCAGCGGGGGTGTGATATGCCTGCCACCTCCAGTACCGACCCTTGAGCCATTGCGAGTCGAAATAAGTCGCGAA
TTCTTTCAGATGCGTGGCCCCCTTCCATTTCGGCAGCTCACGATCTCGGCACAGCTCAAAGTCCAGCAAACCGGTGGCATAGTGCATGTCAACGATAGAT
GACATCACCATCCTTCTTGTTTTGATCGGTAGATGCTGGATTCGCTTCCGCACATTGTACAACACATGGAAGAAGCACATGAGCTTTTTAGTATCCGTGA
ACGCCGAAACAGACTCTACTGTGATGTATTGGGCGTCTTCCGCGTCACCCATGGCTGTGTCCACTTGGACGAAGACCCCACGCACTTCAGGTATAAGCTC
CACGAAGCTGCGGAAACACTCGGTGTATTCGTGCGCTGTTCGCCGACTGACAACGAAGAAGGCCCCCACTTGATAGGCTCTGGCCTTGTCCGTAAATCCA
CACGTCACCACTGGGTACCCTATGTCACTTAACTTGAAAGTGGCGTCTGCGTGAAACTGGCAATTCGACCCGAAATTTACAAACCGCAGACAGCCATCAA
TCATCGCTAATGATGTTATGCCAATAATGAAAGGATCTTCATCCGACCCCAACCCAACGTATGCATACCCTTCGCTGTCTAAGCTCGCGCCAAACAAAAA
GGCCGTGCCTGCGTTTAGGTCCGGGCGGTAACAGCGAATACGAACGAGATCTTGAACAGCTTTGCGAGAGTTCTTCGTCCCTTGGTCTCTCCGAAGGCGC
TTCAACGCGTTTTGCACCTGCTTCAGGCTTGGCCAACCACGACTAGCCACTGGGATCTGGGATTACTTTTTCAAATTGACCAGCATGAGCCGTGGTGGAA
TACCCATCTCATCTTGTTCTGCAAGAAATTGCTTCATCATCATCGTCACGCGTGCAGGGTGGATGGTACTGCATGGAACCACACCACGCATGTGCCCATG
CTCATTCACCCATATCGTCCAGATATCGCTAGCCGTATAGGTAAACACTTTCCACACAAGAGCACAAACCCCTATGTCGCTGCAGGTCTTGCTTGTACAC
GTAAGGCGTCTCTCAGTCATTGCATGCATACCCCATATGCATACCCCCGCATACGTTGCATACGTGAAAGTCGCGCTTAAGTGTCACCGCCGAGCAGCAA
ATATCATCGTCTCGATAGGCCTTAAAGCTGTCTTCGGAGGCGTGGACTGAAAGCCGCCGCCATGGCTCCATTGCTGGAAGTTTGTTGTTTGTGCTTGTGA
CTTCACTTGTGTGGGGAGCTACGTATAGTCGTTGGTTTCAAAGGGATTCCCCAAAAATACAGCACAAGTATGTTTAGATATTGGCAAGATTTATTTGTTC
AACCATGCCAAAGTACGCCGGTCAGCTTGTATATCGATACCCCGCTCGTATGTTATGTACCCATTCTACATGATATGTATGACGCAGCCCCATCTGATAT
GGAATGCCCCCAAGTCTGTATATTTTGTCCTAAGAATCTGTATATTTGTACACCCTCGTCCGCAGCGAGAGTAGCGCGAGCAGGCGGAAGGCTGCACAGG
ATGAGGACGTTCCTCGGGATCTCACCGTGCTTCATGTAGAAGCCATTCTCCACGTACTGCTTGAGCGTGATGGTACCGACAGTAGGTGGGGCGTTCCTAA
CAGAGCTAGCAATCGGGTACCCGAACCGGGTAAATTACCCACCCGCATCTTGCCTTGACGCTCCGCGACAGCAACTACGTGCCCACGGTGGTTCTTCAGA
CAGCACTCCCTTGCACCAAATGTCGTGCTGATCCCGTGCTCACTCAGGCGTAGTCAGTTGCTTGGTAGATGAAGCCGAGAATGGCCCCCAACATGACGCT
GATCATCAGGCGCGTCAGGTTGTACGTCGGCGTTCGCCAGTACATGTGGAAGAATCGGCGACACAGCATGTCGAACTGCATCATGGGGGTAGAAGCAAAC
TGCTTGCCGAATTTCAGCTCGGGTAGATCCGAAGACGGACGAAGGACGCCATCTTTATCCAGATCCTTGTCCATCAGCGTCTTGAGATCACTAGTTGAGA
AATACTCGGCAAAATCCATGCCGTTGCCAGACCCACCGCCAACACCAGCCCCAATGCACTCCAACATCCACGTCGCCGGGTTGTATCCAGGCTCGATCGG
CTTCACACCCGGAGCTGCCTCGAAGTAGTTGATGAGGTTGCTGGATTCCTTACCGAGTTCCCCAAAGAATACCATGCGACCTCCTCGGCGAAGCAGCAGA
AGCGAGTCGAAGAAGCTAAACACTTCAGAACTGGGCTGGTGAATGGTACACACAATGGTTCTTCCAGAGTTGGCGATCTTGCGCACACCATTCATGATGA
GCTTGGCCGAACGTGCGTCCAGACCACTGGTGGGTTCGTCCATGAAGATGATACTAGGCTGCGCAACGAGTTCCACGCCGATAGTAAGACGCTTCATTTG
CTCCGTGGATGACCCGCGGATGATCTTGTCAGCGATGGGCCCCAGCTCCAGCAAATTGATACACTCGTCCACCGACTCCATTTTTTCCTTCAACGGAATG
CTCGCGTTCTGACGCAACATGGCTGAGAACACGAGAGCCTCCCGAATCGTTGCCGATTCCGAGTGGATGTCCATTTGCTCGCAATACCCCGTGCATCGAC
GAATGGCGAGATCGTTCGCAGGATACCCGTTGAGCACGATCTTGCCCCGAATTTTGCCTCCGGTCTTCCTACCAGCGATAACGTCCATCAACGTCGTCTT
GCCTGCACCGGACGATCCCATGAGAGCCGTCATGGTTCCTGGTTTGGCATATCCAGACACCCCTTGGAGTAGGTCGATGTCTTCCCCTTTCTTCCCGCCG
GGCATTGGCACGGAGTACCAAAGCTCATGAAACGCCAGCGTGACGGGCGGAGCTTTCGCTTTCGAACTGGTAATTGTGATTCCAGCTTCGTCAGATATAA
CTCCACTTTCTCTCTCGGCGGTGATTGCTTTTGTTTGAGTTTCAAGGTCGCTCACCACTGCTGTTGTGTTCTCCGGGCTTTCATAGCGCTTGTACTCGAG
AATCAGATACGCGAGGAAAACGAGAACGATGTATCCCGCTGCGAAGTAAATCCACCCCAGGAAAACCCAGAATTCGCCCGTCGGAAGACCGGAAAGCTTG
AGACTATATTTATCAAATGTCGCCCCGAAGCGAGTGCAGTAATTGATGCCGCCGTAGACGCAGACGTCGAACTTGGGCGCGAGATACTGGTTCACGCTGA
GTGATCGAATGCTCCATGCGAGTCGGGTCCAGCCAGTAGAACCAGATAAAATAGTTGGGGATATCTGTCTCGCAGCAAAACCCACCAAACATCACGAAAA
ACAGAATGGAAACCATCACCACGGGCTGAGCAATCGTGATGCTCGGAGCAGCGGCTGAGAGGAAGAAGAAATAGGCTGTGAACCACATTTGACACAGGAA
GAGCGTAACCAGAAAGTTAATGAAGCGGTCGACCAGTGCGACGTAGCCGCCCATCCAGTAAACGCTTGACCCAAAGAGCAGCGTCTCCAGTACGGCGAAC
GGGATCTGCGTCAGCGATGATGCCATAACGTATGCGATCGATCGGAAAAAGTTAGCCCGCCGTTGCTTGTAAAACACACTTGGAGCCCCCATCAAGGTTG
GTAGCTGTGCGGCTTGGTCCATGGAGAGAAACATGGTACACGAGAAGAGCAGCCCGAGGATGAGCTGGCTATTCGAGTCGTTCATATGCCAGAACACGGA
ACCGTAGAGCAATCCCATGACGATCACCATGAAAGCTCGACCGAACATAAATGCTTTACCTCGCAAACGGAGTTGTACTTGACGCTGCAAGACCACCGCG
AGGTCTTCAAGAAAGGATTGATGGGGTCTTGAAGAGGGTCAAAGACCTCGGGAGTCGAGTTGGATCGGACCCTCATGTAGCTCAGCGTCTCCTGGAAAAT
CTCCGACTGCGCGAAGCGATCTGCAAATTCCGCTGACTCGAAGGGAACACTTGACGTAGTGTGCTCTTCGCTAACGTAGGCATGCTGCTTGTCGGTCCCC
AGATCTAGCAAGAAGTTGGCCATGCGAGGTGGACACTGGAATCCCATCTGCTCTGTAACAGGGTTACACGAGAGTTACCCGATGGGTTACGAAGTGGGTA
CAAACTGTCTAACCTAAATCAGTAGGATAATCAGTACATGGCTTCAGAGCCACTGATTATGCATATGACTAGGGTTCACTATGCTAGATAGTGAACCGGA
TACATTTACACCATAGGCGGCTTTGCCGCAATAAAGGGAACTACATTCAGTTTGAGATTCACACAGCTAAGAGTTAAGGGTTGACTCTTGGAGTCCGT