Description :
From Genome Similarity Track
Location :
scaffold_325:26379- 28500
Sequence
2121 bases(100 bases per row)
TGCGGTGCACGTAGCCGTGCATCGTCTTTTGAATAAGGATAGCATGGTCCTTGAGAATCACGTTACGGCGGTCCTCCAGTCTCTGGAGCAGACCTGAGCT
GAAGTATACCTTGGTCTTACCCACAGCAAACTTTGTGTTTTGCATAGTGGTAGCCATGTCGGGGATCAGTTCCTTGAGCAGACCAGCAACCATTTCGGAA
GGCTCTGCATCGCGCAGTGCCGATGGGCAGATAATCTGAAAACGTTGTTGGAACTCGATAAGCGGTAAACGGTTAGGGAAGGCTGCACGACTGATGCGGA
TAGCGGCAATCACACCAGCACAACGAAGTTGCTCCACAATCATGAGGCGGTTGAACTCCACAGCGCTCTTGTTGGCGTTAGGCTTGATACAGCGCACATA
CTGCGATGAAGTCTTGTTGATAGTCTCCATCAGCTCCGATAGCTGCTTGCGGAAGGCACCAGCAATAGTGTTACCCACCAAGAAACCCTTTTGGCGTCCC
TCCTTTCCGTTCTTGCCACGGCTGTTGCGCTTGCCCTGCGTGGGTGTGAAGATGCCCGAGATGACGTCGTTCGAGCTACCAGACAGTAGCTGCACCATGT
CTGTAGGCAGTGTGTCCTTGTTCTTTTCCAGGAAGCCCGAACCGTTGTACGTCACATCACCAGCGTAGTGGTGGATAGTAAACTCCAAGGGGTTGATTCT
GTTCTTCTCGATGCTAGGGTGATCGCTGCAAGCATCCAGAACCTTGCTCACGAAGGTATTGTCCGTAGCCTGGGGACGCAGCACCTCCTCATTCAGCATA
CTGACAATACCCATACGACCCTCAATTAAGTCCAGAATGGGCTGGTTGTCCTCGAACGTCACGAGCGTAAGCGGGATGCCTTCATCCACGTACTCCTGCT
GCACGTCCTTGAAGACATCACTGTTGAACTTCTGTTGCAGTTTCTCGTTCGCGTAGTTAATGCACAACTGCTCGAAGCCGTTCTGGTCGAAACTCTCGAA
ACCAAAGATATCCAGCAGACCAATGTGAGTCTTGACGTTGTTCGTTGAGCAAATAGCTTTGTTGATACGGTGCACCAGCCAGTCGAACAGTTGAGTGTAC
ATGCCCTTAGCAAGAGCGTCACGCAGGTCTGATGCCTGCTCGGCGTTTAGTGGAATGGTGTACGACTCGGAACCAGCAGTAATTGAACGTTCCAGCAACG
TCGAGTGCAGTGCCGCGCTCTGAGTACACAACAGAGCACCAACATTGTCCACAATGTCCTCATTGCTCACATGGCTCTTCTCACTGTCATTGGCATTAGG
CTCAAACTCCACTTCACCAAGGTTAAGGATAGCAGCCACGATTTCAAAAATGGCATTTTGCTCGTCCTTGGAGATACCAATAGTATCCAAAGCATCCTGC
GTCTCCTTGAGACACTGAACATCATCAATACCAGTCAACTCGGCATCTGCACCTTCCGTCACGTACTTGTAACTTGTGGCATCTCCACTCAGTTTGAGTT
CCGTCTTACGATCTTCAGGTAGACAGAAGATCTGGTAGAAGACATGATAATTGCGCTCTCCCTCGGTTTGTCCAACCACACGACTTTTTTCCAGCAAATA
GGTCTCACAGAGACAACCCACAAGAGAGCCCATAGTATCAAACTGCAATTGTGCAAATTTGCCAAATCGACTCGAGTTGTCGTTGCGTTTGGTCTTGGCA
TTACCAAACGACTCCAACAATGGATTCGACTGCAACACTTGATCAATCACCTTGGTGCCATGATTCCCACCTCCTGAAATGGAAGCTAAATGGTTCATCA
TAATCTTCACCGTCTCCGTCTTACCAGCACCCGATTCTCCACTAACCAAGATACTTTGGTCCACTTGCGTCCGCTTCATGTCCATATAAGCCGTAGCAGA
GAGTGCAAATGGATGAGGAGGTAGCGAATCTCGTGGTTGTTCCAGATATTGGAGATACAACTCCCGACCGTAGAGATCGAGCCATTGGTACGGATTCACG
GCAATACAGATAGCACCAGTGTAGGTATATGGCATTTTCTTGGCAAAACGAAGCTCCAAGTTCTTGAGCACAGCAGGTTCGTGGAGATGGTTGAGTGTGC
ACATGTCATTGGCTCCATCAG