Description :
From Genome Similarity Track
Location :
Scaffold_144:26372- 41075
Transcript NameFunction/comments
Phypl_g4118hypothetical protein
Phypl_g4119hypothetical protein

Sequence
14703 bases(100 bases per row)
TGCTCTCAATGCTCTTCAATTGGGTATACCAATGGATGTCCATCTCAGGTGGACTACCTTATAAAAAACCTTTCCAAATGAGGTTTTTCGCGCAACGATT
TGAAAATGAGTTTTCCTGCGTCGATGGCGGACGCGATGGAGGGGGAGGACTCCTCCGAGGAGTCCccgacgcaggagctgcacgagcaggagccgGAGCC
GCAAGAGCTGGAGCTATGGTGTTTGGTCGTGGGCATGGTGGGCACGGCGTTCCCCGTCATTGTCAAGAGAACCGACCGCGTCtgggagctgcagaagacg
aTCAAGAACGAAGCTGTGGAAATCTACGGAGACTTTAACGCCGCTCAGCTGAGGGTGTATCTGGCCAGAAAGGACAACGGCGAGTGGCTCACGGCTGGTG
AGGTGAAGAACATAGAGAACGGCGACACCGAACCGGCCAAAGCCTTGCTGGTCAGAGGCCACCTGGCGTCCATGAGCCATTTGCAAGGGATCTTCAAGGA
CCGTGACGACAACGTCGTCCACATCCTCGTTCCAGCGCCCCAAAAGGCTGCGGAGGTACAGGTGGCAGCAGACATTGCAGGCAAGAGGAAACGATCGGAG
CAGTCGATTGGAGACGCTGAGACCATTGGCGTTTCGGCTGAGGAGCTGAACCTCCTATTTGACGTGTTGAAGCAGAAGAAACAGATTGAGCAAAACCTGA
TCCCAACCTTTGGTCTGAACGAATTCTGGCAAGGGTACGGAGGGTTTCCGTCGTCGTATTTCGTGCGGGTGGAGGAGCTTGTGCTTTGGAGACTGGTCAT
GCGGATTATGTCGAAAAGAGACAAACGGGTCGCGATTGTGGGCTCAGCTGGAGTTGGCAAGTCGTGCTTCCTCATGCTTGTCAGCTTTTACTTGGCATTT
gtcgagaagcgcaaggttTTGATTATTCGGCGCTTGCACGATTTTTCTGAAGCTAGTGGTGTGATTTATCTTGACGGCGGAAACAGTACTTGCATTAGAA
AGACTAACCTGTCAGCTGCAAAAATTTCATCGCTTCCTGACAGGAAAGAGTTCCAAGGCGCTTTGATACTAGTTGATGGTTACTCCCGACAGGATGTTGA
TCATCAATTTGGTATCTTCCCATACCAACTTATCGCGTCACCCATCGAGGGTGAGTGCACCAGCAACGAGTCGTCAAGTGAACTTGTGCTTCCGGCGTGG
CGGTTTGACGATTTGCTACAATACGCTGAATCGACGCTAGAGGACTGGAAAAAATCGACGGGCCAACAAGATCAAGCGAAGCAAAAATGCACACGTGAAC
TTGCCAATGAACAGTACTTCTACAGTGGTGGAAGTCTGCGTGATTTTTGCAGATATCGCACAGATGTCAAGAACGGGATGGATGGAATATGTGGTATTGT
GCATAAGGCGCAGACACTCGACTTGGAGCTTCAGCAAAATCCCCGAGGGGGCAATTTGTTGGATCAAATTCGGCGGCATTACGTCGTAGATCCAAATAAC
GAAGAACACTACTGGCTTGTTTCTCACTGGAGAATCGAGATGGATTCTGGATATGCATTTAAGCGGATAGGGCGCTTTCTGGACGAAGAAAAACAACGCA
ACCTCTACCAGCTCGCTCAAAAGCTCCAAGCTGGATTTGGGGGCTCGGCATTTGAACAGTGCTTCTTTGGCGCAGTTTGCCGGTCAACCAAGAGGTATCC
TGTGCAGATGGTAAATGTCGTGGTTAACTCAGACCCGTCGTGCTCAAATCAGAGATACGACCGACTTGTACTGCGCGGTCGACCTTTTGCATGCGAGGGC
AGCACCGAGGAGGAGTGCTATGAAGAGTTATCGCAAGTATCTTCAGGAAGTTATTGCCATCTCGGCAATGTAGATTTTCCTTTTGTCAACGCAGTGGTGA
TGTGCGAAGGTGTTTTGAGAGGGGGCAACGTGAAGGAAACTATCGTTGCCATGATCAGCACTACTGTATCCAATAAGAAACCATTCAACCCGGAGCTCTG
gacgaagctgaacaagGCACTCGATGGCAACGATAGCATTCCGAGCAGTGTTCCACGCGTGTTTGTGGTGGTGGGTCCTGATACCAGCACTTGCAAAAGA
TTTGCCTTGATCGATGCGCCCGCTTCAGATGACTTCATGGTATGTTGCTACGACCCGCTGAAGTTTTACCGGAGACCTACTGTTGCCAGGATATCATAAT
AGGAAGGATTGCAGGGTATAATAGTAACTTCCACACTACCATTGAAACCCACCAAAATTGGTTATTACCGCATCGTTTCCTTCTTCAGGTACATGTAACA
TCAAATTCGCAGACAGCCAACGTCACTTTGAGATCCTTGGGGAGCCTGCTGCCCGTCTCAAAGTCGATCTGACGTAATCGAGTCGCGGAGATGCTTACAC
GGTAATCACGCGTTTTCAGCCAGTAAGCGCTCCCCCCAACGCTACTCCTTTCTGTGACCTATGTCACAGACTGAAAGAGCGGCACGACGACTGGTGAGGT
TTGCATGACTGTCGTCTTCATTCAGTCACTTCCCTCGTGGTCCGCACTCCGCAGTGCAAGCTGAAGCGCCATGGCCACTGCAACTGCCAAACCGAATCCC
CGCGACGTGCCGTATGCCCAGCTGGTGACTCCGCGAGCGGCTGCGAGCAATTCACTAGTATTCAAAAACGCGACTAGCGAGAATGACACGAGGCAGTACC
CACGAGCAACGCcgccctccttctcgttCCTGGATCTCTACCGCTTCGCGACGCTTTCCGACCGCGTTCTACTCGTGTTGGGCGTGTTCATGGCGGCAGT
CAACGGCGCGCTCTTCCCGTGTATCGCACTAGTGTTCGGCAAGGCTATCGGGGCATTTGCTCAAGCAGACGGCGGAGTTGACCAGGACGAATTGAACAGT
GCATCGCTCGACTActtcatcatcgccatcggGTTGTTCGTGACGGACTACTTGGCGTacttgctcttctcgctctcggcCGAGCGTCAGATCAAAGCTC
TTCGTGCACATGCACTGGAGCACATGCTTTACATGGACATTTCGTGGTATGATCTTCATGATCCTCTGCAACTGTCGAGCCGTATCACGGGCGACACTGT
GAAGATCAAGGACGGAATGGGGCAAAAGCTGGGTGATGGAGTCAAATACGTGTGCCAGTTTGTGACGGGCTACATCATCGGCTTGGTGCGTGGATGGGAT
ATTGCGCTAGTCATGACCTGTATCATGCCTGTCATGGGATGGTCAATGACTTATGTGATGAAGAGATGGCGATCGAGAGCAACTCATGCACAGCAAGTAT
ATGCTGAGGCGGGGGCTGTAGCTGAGGAAACACTAGGCTCCATTCGTACCGTCATTTCGCTTACAGCTGAGAAACGCGCGCTTGCAAAGTACAACAAGCA
CACGGCTGAAGTCGAGAAAGGAAATATCGAGCAAAGCAGAGTACTTGCACTTATGCTAGGACTGTTTCGTGGCTGTGACTGGTTGATGTACGCTGCTGGA
TTATGGTATGGAGGATCTAAAGTGTGGAAAGGAGAAGCATCCCCGCAACGAGTCTTTCAATCTCTCATGGGCATTCTCATGGGCATGCGGGCGCTTGGCC
TCATCTCGCCAAATCTAACCGCTGTTATCGAGGCGAAGGGCGCAGCGGTTGCGCTTTATGAGCTGCTAGACACGCAATCTCAAATCGATGCGTCTCAAGA
AAGCCAGGGAATTGTTCCAGATGCATGTTCTGGTCAGATCGAGGTTAGGAATGTCAACTTTGCATACCCAAGTCGACTAGATGCCCCGATTTTGAGAGAT
TACAGCGTCACGATTGATAGCGGGCAGACGGTTGCATTTGTTGGTGCAAGTGGCGGCGGGAAAAGCACTATCATCTCGCTTCTGGAGAGATTTTATGATC
CTACGAGTGGTTCCATTCTGCTTGACGGGCGAGATTTGAGAACACTAAATGTGAAGTGGTTGCGCTCGCAGATTGGGCTGGTGTCGCAGGAGCCCGTGCT
GTTTGCAACCACCATCGGAGGAAATATTGCGGCAGGTCGGACTGACTTCACTCGCGATGACATTATCGTCGCCGCAAAGATGGCCAACGCTCACACATTC
ATCATGTCCTTACCCCAGAACTATGATACATTGGTTGGAGAGAAAGGTGTATCGCTATCCGGTGGTCAAAAGCAACGGGTGGCGATCGCACGTGCAATTA
TCCGTGAGCCGAAGATTTTGGTGTTAGACGAGGCCACAAGCGCTCTGGACGCCGAGAGTGAGCGGGTAGTGCAAAATGCTTTGAACGATTTGATGGCAGA
AACGAGTATGACGACCTTGGCAATAGCTCATCGCCTTAGTACGATCCGCCACGCAGATAAAATTGTCGTACTGGCTGACTGCCACGTTGTTGAAGAAGGA
TcccacgacgagctggtcgagctAGAGCATGGTGTATATCGCAGCTTGTACACGCTTCAGGAGACAAAAgcacaaggagaagctgaagctgctgcgtcgg
aTCTAGCTGAGTCTGAGCGAAGTCAGCAGAAGGATGAATCGGACGAACATTTGGCTCGGAAAGAGAGTATCCGTTCTACGAGAAGTGATGGATCGAGAAA
CAGCGGCCGTACCAGTGCTGTTGGCCTGAATGACCCCGTGGCAGAGGACGATACCCCACGTAAGTTCACTGTGTGGGATGCTAATGCTCTCAGCAAACCT
GAGCGCGGGTATTTCATCATGGGTATTATCGGGTCGGCAATCAACGGTGCCTCGTTCCCCGCCTCCGCTGTCCTCATAAGTCAGTTGGTTGCGCTCATGA
CGTTGGATTATGCCAATTACGAGGAATACGATGACTTGTCGTATTTATCAAGCCTGCCTCGCAAGGTGGCCGTGTATGGCTGCCTCTATATCGCTGGGGG
GATGATAATTTGGATCGGACGAGCTTGCCAGAGCTATGGCTTTCAGTACAtggcggagaagctgacTGCGCGACTTCGAGGAATTCATTTTTCGTCACTA
TGCAGGCAGAACATCGCCTTTTTTGACGATAACGATCACGCAACTGGAGCTCTCACTGCTGACCTAGCGACGGATGCTTTGCGTGTTGCGATGATATCTG
GTGAGTCTCAAGGCCGCCTTTTCCAAGCCGTTTTtacgacagcagcggcactgCTAATCTCTTTCCTGGCAGGGAGCTGGCTTCTTACGCTAGTGATGCT
TGCCATCATCCCATTCCTGATCCTTGGAAACGTGTTTCGTTCAAAGAACACACGTGGGAGCAGCATTCTCGCCGACGATATGGCGGATGTTGGAGCGCAT
GCGTCGGAAATCCTCGGTAGCATTCGCACCGTTGTGTCGCTCGGGTTGGAAAGGTCTTCATGTGAGAAGTTCTCGGTGCTCCTCGAGGAGCCCATGAAAA
GTGGCGAACGGGATGCACAAGTGAACGGTCTGGCTGTCGGCTTCAGTtccttcatcgtcttcgcgACATACGCGTTTGTGTTTTGGTACGGCGGGAAACT
GGTGAATGATGGATCAATCACTTTTTTGCAGCTGATGCGTTCACTGATGGCTATCATTATGTCGTCACAAACTGTGGGGGCCTCTGTGGGGTATGTAGCA
GATGCAGACAGCGCATTTGAGGCAGGAAGTGTCATATTTTCTCTTCGAGACCGGCGACTACCCATTGATTCATTTCAAGAAGATGGACTGCGCCTTGACA
CTGTCATGGGCAAGATTGAGTTCAAGGACGTCCTTTTCTGCTATCCAACGAGGCCCGAGGTGACTGTGCTGAAGAACTACAACCTCACAATTGAAGCTGG
TGAGACTGTGGCGTTTTGCGGGCCAAGTGGGGGTGGTAAGAGCACGtgcgtcgcgctgctggagcgatTCTACGATCCTGTCCGCGGCCAGGTGTTCCTA
GATGGAGTGgacttgaagcagctcaacgtCCGGTGGTTGCGCAGACAGCTCGGCCTTGTTGGCCAGGAGCCAACACTCTTCATTGGCACGATCGCAGAGA
ACATCGCGTACGGTTTGGATGAAATGCCAAACATGGAGGAAATCGAGGAAGTGGCAAAAATGGCAAACGCGCACGACTTCATCACGCAGTTCCCGGACGG
CTACGAGACACAGGTGGGAATGAAAGGCGAGCAGCTTTCGGGAGGTCAGAAGCAGCGAATCGCGATCGCGCGTGCCATGCTCAAGAACCCTAGTATTCTA
CTGCTGGATGAGGCAACGAGTGCACTCGATCTGGAAAGCGAGAAGGTcgtgcaggaggcgctggacaaggtggtggccatgCAACGGCGCTCGACCATTG
TAATTGCGCACCGCTTGTCTACTATCCGGCATGCGGACAAGATCTGCGTGGTGAGTGGCGGCAAAATTGCGGAGCAGGGCAcgcaccaggagctggtcaG
CTGTCATGGAATCTACGCCAAGCTGGTGGGGACGGCTTCTTCGTAGGCATCGTCGGGTAATTCCATATAATCATGCGAGTTTGTTTGATGCTGCAAAAAA
CCCTCCACATGTAACATGCTCATGTTCGCCTGGAGGTACAGCGTGCTACATGCGGTTGGGTATGAAACACGTTTGACACGAAGATGTTAAGAAGAGATGT
CACGTCTGCAGAGCTGTAATGTATTACATGTATTCTTATCGATCTTCATTCTTCAGGCTGATCGAAGGCTCGTGGCAGCCCCACGATGTGCAAGCAGTGG
AATATATGGGCCGATTCTGGCTGTTGATGTCCAAGCGCATCATTTTCGGTGAGTCAACACGCGCGCGACTACCAAATGCACGCTGGCAATACGACCCAGC
CTGTAATCATGGCACAACTGGTCCTGCAAAGTGCACTTTGCTGTGAACAATTGAAGTCAACATACGCGGCATTGCGGCATCGCGGCATCACCCGGGTGGG
ATCGCCTTGAAACCAGTCAAAAGCTCCGGAATGCTCAACCCCAAGCTCGCTCGTGTCAATCCCGTCAGCATGACTGACACCTTATCGCCTCTTGAACAAA
GTGCCCGCCTTGTTGACATCCTCATCAGGTTTCGATGACTGTAGCCATGACCGTTGGCCACCGTCGTACTTAGTCGAGTGTTGATCTCAATTCAATGAAT
TGCAGCATACAAACTCCCAATCTACATtatgtgcgccacaccactTATTCCATAGGCGaccacggacgacgccattttgcgagagcgagaagagcgcgCT
CATTGTTgacctgaagctgctgacccGCCGGCCCTGCGCACCCCAGACCCGCCGCCGCTACTTCTTCCGCGCGACCAAGTGCGAGGCCCATGGACAGCGG
CGCCCCCGAGCCAGGTGCGTCCTCTACAGCGGAACGAGCGGCAGAGGCCGTCGTCTCGGCCGTTTGCGCCTCTTCCAGCGTCTTTTTCGCGTGGAATACG
ATGCATTTACGTGGTATAAACCGTTCTTCTAACGATTACATCGTCGCGTTGTTGTATTTTGCAGCCACTGCGCCCGCCAACCAGCAGGCACAagccccag
cagcgactccgGCGCCCGTTGACGCTACGGAGCAGAAGCTAAAGGCTGCGGAGCCCGAGACGAGTCCTGTCAGCGCTGGTGCAGATGCAGTGAAGAATGA
GGCGAAGCCGGAGAGCCAGccgaagagcgaggacggTGGCAAACGTCGTAAGCGCCGCACCAGCAAGAGAGTGACATACGTGGAGGAAGATGACGTCtcc
gagggcgaggaggccgtCATAGCAGATAAGAAGAAGCGTGCACAGCAACTTGACTATCAGTTGAGAACAGTACGTGGACTCGTGgcctttgctgctgctg
ctgcaagttgaagtgagtGAGAGAGAATGTACTGATTTTTGTGGTTGTGCAGGATGTGGGCTACCCGCAATTGGACCAAATAGTTGGACGACGCGTCAAT
GAGTCGACGGGACTTGTGGAGTACTTGTGCAAATTCCTTGGTCGCTCGTACTTGCACCTGTACTGGCTTACGTTTGATGAAGTGGAGTTGTTTATTCCGG
AAGGATATCAGAAATTCCACCGCGTGCACGTGTACGATCGAAAACTGAGACGTGAGGGATACCAACCGCTGGACGAGGTAGACGATCTGGAGGCCAACCA
GCTCACTGTGGAAAAGATCTTGAACCACAAGGTAGACCCGGCCGACCATTTGGACGAACAGATCGAAAAACGCCGACACCACTTGACATACGAACCCAAG
TTTCCACGTGTGACAGACAATTTCTTGATGGATAATGCCGATGTCATTCCGGAGCGCATGCTGGGCATCGTGACAAAACTGACGAAAGAACCAGGTGGCG
ACATCTTTGAGCATCCTGTTGATGTTGAAGAAATTCCTGACTACCTCAATTTCATTACGAACCCTATGGATCTTGGAACGATTTCCACGCGACTTGGTCG
GGAAAGTTACTACATTGGACCGTCGGCCGTGTCATTGTTTGCCTCAGACGTACGACTGGTATTTCAGAACTGCAAAACATACAATGCTGAGGGATCAGAC
ATCTGGCGCGTTGCGGATGGGCTTCTACGCACCTTCGAGAAGTGGTTGTACGATTGGGTACTATCCCCAACAGCGTGGCTAAAGCTACCGCCTTCAGGAG
ACGCGGAAGAAGACCAACGACTCCAAAAAGAGTTTcgcgcagaagcagaaggctTTTACGATGTGTGGGCGGCATGGCAAATCGGCTGTTGCGTGTGTGG
AAATAGTGATCACAGTGATgagctgttgctgtgtgACCGATGCGACGGTGAGGTTCACATGCAGTGTGCCACCCCAAAAGTCACGGAAATACCGGTCGGA
GAGTGGTTTTGCGGGTATTGTCGATCTCGTACAAAGTTTATTGTAAATACTGAGAAGGAAAAGCAGGATTATGGCGAAAACAAGTCGAAGACTATCGAGA
CAGAAGCATCCACTGGAGTTGCAACTCCTTCAGCCTCAGGTTCAACCGCAGCGTCTAAAGATGCCCTCGCAGACATGAAGACAACTACCTCATCTACGCA
CGCTCCCAATATCCTTATGGAACGCGCCGATGGTGAAGGCAAAGTTAACAAGAAAACGTCAAAGCGCAGCCCTAAAGGTACCAACGCAACAAAAAGCTTG
GCACCAATCAGCATGAAAGATCGCGCTGCTACATTTTTCCTTGTCAAGTGGGTGGGTATGTCGGTTCGATTCTCAACTTGGGAGCGCCCCGAGGATATTG
GTGACGATGAGCAGATCCAGAGATATTTCAAGTTCAGCCGTGTGCCTAGCGCGAAGGAGATCAGTGAGACTACGTGTCAGTTGCCATGCTGCGCTAAGCG
ACACCAGTACGCGCTAGCCACGAGCACAAGTGGAAAGAGATGCTGTGAAAAAGACCGCTTCTGTACTCTTGGGTATGGCCACGAGGGTGATTGCAGTCGT
AGTATTAAAGCCCTGGGAGGGGCCtacggcagcaacgcgtaTCAGCGACTGCACATGCAAGAGCAAGTAAAGGCGCAATTGTTCGCCTTTCATTGTTTGC
TGAACAACCACACGCCAGACAAAGATGTGCTCAAGCAGTGTGGTATGTACACGAACGCGTTCATAACCACGAAACAGTACCTGTCGCCGAAGGCTTCCAa
agaggatgacgacgaagattACTCGGATGATGGGGATTCGTCTGACGACGATGCTGACTTTGATACTGAAACTGATTATCTGAATCGGCCAACTCTCTAT
CCAGGGATCCTGACCCTGGagaatgacgacgacgacgacgatgacgaaaCTGGTGGGCACAAAAAGAAATCAGAGGAAGAGGTCGGTGAAATGCTTAGCT
CTCTCGTCGAGCACGTTGCTCTCGGATATCCAACCAAACTGGAGACTGTCAGCGCTGAATTCCGGTTTGACTCGACATACCCAGCGACAGCTTTCAAGGA
GCTTCCAGCCTTCACGGAGTACTGCGTCATTCTGGGTCGATCACCTTTCGGTTTAGGTATGCGTCTTGGAGtcagcagtaccagcagtgTATCGGTTTTG
GGATTCCAGATTCTTGCGAATGGTATGATGGGCCCAGCTCAAGCGTCTGGAGCTATTTCAATTAGCGACGTGCTTGTAGCCGTGAACAACATATCGGTAG
CCGGTCTTTCGTTTCAAGACGTCGTCGGGTTGATCAGTGCGTCTCCCCACCAGATTCTTTTCCACTTCCATTCCCCCCGGCCAGCGTTCATGTACCCTCC
GTACTGCCAAGCAAAGCAGGTGACGAAAATTCGCTTGGAAAAGATCCCCGACGATGCGGCACCTGAAGGCTCCAAGTACGCGGACTACACATATACCAAG
TACAAACGAATGCTGAAAGTGGGAGTTGCAGATCCAGATGTGGCATCGGCCGCTTCGACGCAGACGTTGATGCAGCATTCGAACTACATTGCACCAAGCG
GTCCCATGCAACATCTATACGCTGGGGTCGTTGACAACAGTATCGATCCACACGAGCATTTTGCAAGCTTCCTTCCGGAgaggagcagctcagcaaATGG
AGGATCGCACGGCAAGATTGAGGGTGCAAGTGGCCATGGAGATCCAAATGAATTTGTTCCGTATGAGCAGTCACCAACTTACAAAGGTGGTCGCACTTTG
CGTGCTTACCAGGTCGAAGGTCTCAACTGGATGGTTTCGTGCATCAAAGCTCAGCGGTCGTGCATATTGGCTGACGAGATGGGTTTGGGTAAGACCGTTC
AAATTGTGTCGCTGATTGAACACATGAAGACAGAGGAGTCCAATCGAGGACCATACTTAATTGTCGTTCCTCTTTCTACGATTCAGCACTGGCGACGTGA
AATTGAGAGTTGGACAGATCTCAATGTGTGCGTTTATCACGATATTGGTGACCGCACCACTAAGTTTACGGCTAAGGATATGCGTGCAGTTATCCGAGAC
CAGGAATGGTATTACCCGGGCTTGGGCAACTCTATCTTCAAGTTCCACATCCTGCTGACCACGTTTGAGACTATTTTGGCGGATTTCGAAGAGTTCGAGC
ACATTCACTGGCGTTTAGTAGTGGTGGATGAGGCACACCGATTGAAGAGCGCCGGATCACGCgtgctgaagatgatgcgCGTTCTCCACGTTGACCGAAA
GGTGTTGCTGACGGGTACACCTTTGCAAAACAACACACAGGAGCTCTGGGTCTTACTCAATTACCTGGAGCCGGTTAAGTTCGCAAGTTTGGAGGAGTTC
AACACACACTTTGGAAAACTGCATTCGCAGGAGCAAGTTGTTAGGCTGCAGCAATTATTGGCACCTTTTATTTTGCGCCGCGTGAAGGAGGACGTTGAAA
AGAGTATTCCACCGAAGGAAGAAACGATTATCTCTGTGGAGCTAACAACCCTACAGAAGCAATATTACCGGGCTATCTACGACAAGAATAAGAGCTTCCT
GTACCGCGGTACAAAGAATGGTTTGCCGACGCTGAATAACATTCAGCTGCAACTGCGAAAGTGCTGCAATCATCCATTCCTGATCAAGGGCGTTGAGGAG
CGAGAACTAGACGAACTTGGTATCAAACCAACCCCAGCTCAAGTGATGGAGAAAACCATCGAATGCTCAGGAAAAATGATGCTTGTGTCCAAATTGATCC
CAAAGCTTAAACGGGATGGACACAAGATTTTGATTTTCAGCCAGTTTCTGAAGCAACTTGACTTGCTGGAGCGCTACTGCGAGGCAAATTCTTTTGTGTT
CGAGCGTTTGGACGGCTCGACTGGCGGAAGCCTGCGTCAGAGCGCGATCGATCGTTTTTCTCGACCCCACTCAAAGTCTTTCATTTTTTTGCTGAGTACG
AAGGCGGGAGGTGTGGGCATCAATCTTATTGCAGCTGACACGGTGATTATCTTCGACAGCGATTGGAACCCAATGAATGATCTGCAGGCCCAGTCACGTT
GCCACCGTATTGGACAAAAAAAAAGTGTTCAAATCTATCGCCTGGTGACCCACAACACGTATGAAAGCGAAATGTTCGACCGCGCCTCGCGAAagcttgg
tcttgagcaTGCGGTGTTAGGCACGGCGTCCTTCAACGAAAACTCTCAGATCACAAAACCGTCGGCAGAACAGCTTGTTGAGCTGTTGAAGCGCGGAGCG
TATGCGCTTATGGAGGACGATGACACCGCGTCGAAGGAATTTGCTGAGCGCGATATTGAGACTATTTTGAAGGAAAATGCTCGTGTTATGGTTGTTGGCG
GGTCCAATGCTAACAAGGGCACGGATGACGATGCAGGAGTGACATCACCAAGACAGAGGAAGTCTCCCACGAAGTCTCACAAACGCAAGTCACTCGGTGG
AATGGCGGTAGACCGTTCATCCTTCGTTGCTGAGGGCGCGACCGGTGAACTATCTGTGGATGACCCGAACTTCTGGGAGAAGGTTCTTCCGGGGGCTGTC
TCGGTGGAAATGCTGAGTTTGAAGCTGGAGGATGGCAGCGCCGTGAACTCACGCCAGTCGAAGATCAAGTTTATCAGCAATTTGGATATTGCTCTGACGA
GCTTGGTCGCCGAGATGAGTTCAGGCAACAATCCTGACGATGGGCGCGTTGGGAGCCGAGACATCCAGCACGAGTACGACATAGCTATCCAGGTATTGAG
TACTGTGAGCTCGAAATACCATGACGAGTTCTCCAGCGATCAGATCGATCTCGTGAAGGGGTACCTATCAAAACTGGAAAAGTCACGTGTGCGAAGCTGT
CGACTAGCTTCCACTCGGACAAACATGTTCCAGGATGAAGATTTTGATACCCCAAAGAAGAAAAGACGAAGGAGAAATACCCCAGCAGGCAGCCGAGCAG
GAAGCGAAGATGAAGCTTACGGTGATACTTCTGCGAGGAAGAGAGGCAGCAAACCGCGTGGTCGCCCACCAAAACACCCGCGAGCCGACGACGCGAAGCC
CCCAACTACTCTTTTCCAAGGCGGGGTTATCAATGACAGTGACGATCTGTGCACTCTTTGTGGCGACGGTGGGTTGATTTTGCTGTGTGACGGTCCGTGC
CATCGTTCATTCCATCTCGAGTGTGTGGGCATGAAAGATGAGCCGAACGACGAGCAGTGGCTGTGCCCAGATTGTGCCGAGGGTCGTCATATGTGCTTGA
TTTGCAAGCAAGTCGGCGAAATGGGTGTCGAGTTTGGTGTCACACAATGCTCGGTAGCCAAGTGTGGCAGATTCTACCATAAGGGCTGTCTGGCCAAGAA
CTCGCGCGTCGAGTGGGtcggcaagaagcgcttccgTTGCCCGAGCCACTTTTGCCATGCTTGCTCGAAGACCAGTAATAAGCTAGCTGCGACCAaaagc
aagaagaagagcgacgacaAGGCTGGTATTGTGAGCTGTATCCACTGCTCACAGGCCTTTCACCCGGACTGCATTCCGTCAGCAGACAAGTTTATACGGC
TCTCGAAGAACCTCATGATTTGCGCGAATCATTTGGACGGGAAAACCCCACCAGCCTCTGCAGGAAACGCGACTGCATCTGGATCAAAACTGGTTGCACT
CCGCGCTGGTGCAGTCCTagctgcggcggcagctcagcagcgactaGAAGTTCCACAACAAATTCCTCtggatggagacgacgaacAAGAGGAACGGGAA
AAGTTAAGTAGCAAGCGCAAACGTGCAACATCTCCCAAGAGGAGTGgatcgaagaagagcaaaTCTGGGAATTCAGATAAGTCGGCCGCGAAGCCTACTC
AGCCCAAGGTCTGCGCGCTATGCCACCGCGGGAGCGTGATGGGAGGGGGTGCTGATGGTCAAGAATTGCCTCCCCCTCCTTCAGCCAAAATGGGGTCACG
TAATGGAAGCTCGAGTAGCGCAGACTCGGCGGGGACTGCAACTGCCGACATGGCTCTGGAGGGGCCTTTCATCGAGGCCCCTGTGCGCTTGAAATATGCT
GACAAACCCAACGAGTCCGTGTATGTACACTTGAACTGTGCGGTGCACTCACCTGAGGTATTCGTGAAGGCCGATGGTCTGATCATGAACTTGCCCAAGG
CAATCAAGCGCGGAAGACAGCTCAAGTGTACCAGTTGCCATAAGTTTGGTGCCACAGTGGGCTGCGTCGTGTCCAAGTGTCGGCGCAACTACCACCTGCG
TTGTGCTGTAGAGAGTGGCGGTGAGATTGATGGCACCACGTACGCTTTGTACTGCAAGCCGCATGCAGCTGCACGCAAGGAGCCAACGCGTATATGCGTG
TGCGATGCCAGTGAGGAAGACCCGAAGCTCACGCTGGTGTGTTCATCGTGTAGCACCAAGTTTCACCCGAAGTGCGTGAACATGTCGGACCGCCACGCGG
CTCGTATGGGGAAGACGTGGCTTTGCAGTGTTTGCGACGGCTCAGCTGCGCCGACGCCCGCGACTCCTACCCACATGCCCCCTTCCAAGGCGAAAGCAGG
AGCGTCAAAGCCCAAGCCAAACAGCTCAAAGGATTCTACCAAGACGACTGCCAAGACAACTACCAAGTCGGCGCCAAAGAAGAAAAGCAGTGACAAGGCC
GAGAGCACCGAAGCTAGCCAGCCGCCCACAccgaagcgcaagaaggcgaagaagaaccGCCTGAGCATGCCGCGGAACAAGTCTCACCCAAAGACGAACG
GCGCGCCCCACGGGATCTCGCCGCACATGGAGGCcgactcggacagcggcgTGTCCACGGACGAGTAGGTAGAAGGTGAAAAGCTCAAAGCAAATATATG
GTA