Description :
From Genome Similarity Track
Location :
Scaffold_44:263708- 266426
Transcript NameFunction/comments
Aphas_H257_12539metallobeta-lactamase domain containing protein
Aphas_H257_12540SET domain-containing protein, putative

Sequence
2718 bases(100 bases per row)
TCAACGTGGAGCAAATGGGCGACCATGGCAATGGCCTTCGTGCACGTGTTGACCTTCCACAGGGTGTGCCCATCATGTCGATCCCAGCCACGCTCCTGCT
CACATCGTCGTCGTTGCCCCCGGCGCTCGCACACCTCCGTCAAGACCCACTTTGCCGGCAATTCCCGACAGTTTCCTTGGCCCTTCACGTTCTCCACGAA
GCATTAGCTCCGTCTTCCTTCTTTGCACCATACGTGGCCGTCCTTCCTCGACAGATGCACCTCCCCTTGCAGTACACCGTGGCCGATTTCGCGGCGCTGG
CATCTTCCACCGCCGCCTATGCTTCCGCCATCCAGCTCTTCTACAACGCCCTTCGCCAGTACCTCTACCTCCACCGTCATTTCCACCAACAGCCGACCAT
TTTTCGTCATGAATCGTTTTCGTTGACCAACTACTTTTGGGCGCTGTCGGTGGCCCTCACGCGCCAAAACAACGTGCCGACACCGGACGATCCGTCTGCC
CTGGCTCTCATACCCGGCTGGGACATGTGCAACCACGCCATCGGTGACATGACCACCTACTCCGACAGCGTGTCCATCCACTGCGACGCCATGACGTCGT
TCGCTCCAGGCGACGAGATCACCATCTGCTACGGCCCTCGCCCCAACGCCGACCTCCTCGTCTACTCTGGCTTTTCGCTGGCGCACAACCCATACAACGG
CCCAGTATCCCTGGTCCTGCCCTTACTCGACCAGAAACTCGACCCACTAGTCAAACTGCGAACGATGCTGCTCCAGAAGCGGAATGCGACCATCTCCGCC
AATGGACTGCATGTGCAGCTGGATGCCCAGTCTGGTCGGTTGACATCACGTTTGTATCGGGAACAGGTGCAGTTGCTTGTGCTGGACAAGCCTTCCCTGG
CCATCGCCCTTCGCCGAGACGTTGACAAGATCAACACCCCCTCCATGGAGTCCATCTCTAACGTCAAAGAAGGAGGACACATGCAGCACTTGATTCCGTG
GCCTGATCAAGAGACAATGGACAAGGCCAACAGACGCCTCCAAGACGCGTGCGCTGCCGCCATCCTGTCCATCAAACACTCGAATGAGACGATACATGAG
TCCATTCGTGCGTTTCTCGCCACCGAACGACGCGTGTACGAACTCGCAAAAAGTCACGTGGTCGAGTTTAAACCTTAACATGACGTTATCATGCAACAAT
TCTGACGTTATACGAGATCAATCATGACGCTATGGGGGGCAACGGGATCGGAATGCGCATCAAGTCAAAGCCGTCGACGACCGCTCGTTTTCGGAACGTC
ACTCTGGCTTCGTCTACCAGTCGTTGGACAGAGTTGGGGCCCAAGAGGCCGGGGCTGAACCGATGGCTGATGTGCGTCAGCACAAGGAGCGTGGGGTTGA
TGTGTCTGGCAAAGTACCCCGCCATGGCGCTGGTCGAATGGCCGCGATCGAGGGCCTACAGGAGGACATCCATTACTCAACAATGCAAACTCTCATATCA
TCAAAGAGATACAGGAACGGGAGGAGGGGGCTTACAATGGCTCCGCTGCCATGGGCTAACGTGGCTTCGTGTATGAGAACCTACAAATACTAGTATGATT
CGAATTCAAACAATTAGAGCTCCACCAGGTACACGTACATCTGCATTGCGGGCCAGCGCATACATGCCAGACGAGTCGGCCGAGTCGCCGAGAATAGCCG
CCTTCCGACCTCGGCGCGATGGCCCCATGACCTAGTCGATCGTTGTGACGTTATCATTAATGCAAGTTGAACCACCCACTTCGTGTGGATGCAGCGTCGA
TCCGTCCGGCAGCTGGACGCTGTCGCCGCCCTTGAGCTGTTTGTACAACGGCCCGGGCACGAGGCCGCGGCGGGTGGCGGCGGCCACATCGATCCGTCCT
GGCCGTGTGTTCTCTTCGACGACGTATCTGCATGAGCCTCTGTTAGACTCTTTGACATCAAAGACAATGGAAAACTTCATACCCGAGACTGGGCACGCTG
TGCGCCAACGCCCCGGCCATCACAGTGTGGGCACCGTCGTCCATCACGCGCCAAGCAAGGGTACCGTCCACCCGTTCTGGTCGAATAATGGTGTGCGACA
GATCCTTTTACGAATGTGACAAGGTTTGCCAGAAACACAACGACAGCTCCTTACCTCGTGCACACGCTCGTGGGGCGACGGAGGAGGGGGTTGGTAGTCC
TGTGGCACGAGTTCGTGGATCGTGATGAAGACGTTGTTCATGTGCGCGCACGAAGCCGTCAACGCCGCGTTCACAAAGTCAAACACCCCCGGCGGGCCGT
ACACGTCGATGGGCCGGCGACCAAGCTGTTTCGTCGACGGGTCCATGTAATCAGCGTTCAATGAATTCAACGTGCAAAGCATGCCCGGCAAGCCAAATAG
GTGGTCCCCGTGGACGTGCGTGAGGAAGATCTTCTCAGTGGTTGTCACGCGCACTGTGCTTCGGAAGATCTGTCGCAGCGTGCCCTCGCCACAGTCGAAC
AGCCAACTCTTGGCCGGCAATTGCACGCACAACGACGACGCACCGCGTTGTATCGAGGGCATGCCGGCCCCAGTGCCCAATAGGACGATCTCAAAGCCAG
TGAACTGTGGAAGCTGCATCATCTGCAGCCGGTGCTTCTCCGCATGAGACTTTGGCACGGACGTCAATCGAAGGTGCCGCAGCCGACGCGCTGTTGCCGA
CAAGTTGCGCGCCGCCAT