Description :
From Genome Similarity Track
Location :
Scaffold_453:263661- 267509
Transcript NameFunction/comments
Aphin_H310_13126PREDICTED: transportin-1-like
Aphin_H310_13127predicted protein
Aphin_H310_13128Hypothetical protein
Aphin_H310_13129unnamed protein product

Sequence
3848 bases(100 bases per row)
TCTCAGGACACTGGTCGAACGTCACGAGCACTTGGACAACGGTCGTGAGAAGCAGGCCGGCCGTGCTGCGGATCTTCGGGTGCGCGTCCGTCAGCAACGA
CAAGATGCTCGTGCGAACATGGGTCTGCATCTCCGGGGTCAAGTTGTGGTACATGTTCTTAATGCTCTTCTTGAGCAAAAGGCCTGCGACTTGGCGAACC
CCAATCTCGGGGTGGTGTGCGAACACGTGCAACAGGTACAGGTGGAACTCGGGCTGGACGCTGTACTGGTTCAAGCGCTGGTACGACTGCTGCTGGACTG
CATTGTCGGGGACTGTGCTCGCCTGGAGCAGCGCCACGACCTCGTTCAGCGCGTCCGAAGCGGGCTGCCAGTTGCTCATGGTCTCTTCGTATTCACCTCT
CGCCACTACACTTGCAAACTCGCCAAATAACATCCACCACCTGGCCATCCGGATACCAATGCCGGGGGTGGCATCCGGATACCACCGGTCGTCCACATGT
AGACGATGCGACGGTGGCTGCGGCGGCCGAGCCTTCCTCGCCACGTTTGCCGCATTGCACGAATGCTCAGACGCTTCGTTGAAGACTTAGGACGATTCAG
AGAACTGCACGTGCCCAACGGAAGATGCGTGTCATTGCATAACCCGATGCAGTTGGCACTCGGCTCGGCGATCTGGTGAAGGCGCGGTCCATTGACACGT
GCCGGGCTTGCCCCTCGCGTGGTTTGCGTGGTGGTGCGGTGCCGGCTGGCTTGGGTTTCATTCCTCTCTCGGTGCCCGTGGCATCGCAAAGGCAAGAGAT
ATCGTGTTGTTGTTGTGAGTCCTACCTAGTCCATGTTGTTCGTTCACAACGAATGCAGCGAGAGGAGTGGGTAAATCCCACTTGGGTTAAACACGCGATA
TGAGTGGATTTTGTGTGTATTGAGCCACGAATCCGTGTTTAACACTTATCCGTTACATTGAGTTATCCGGATGACTGCACAAAAATCCTCAGCAGCTGGC
ACAGCCGACTGCACCGTTGCGGAACTGGGGCCGATGAGTCCGATGCTTCCGCTGGACATGTATGTGATGGAAGAGAAGCGGATGTTTACTTGGACACTCG
CCTGCCCAACGACGACAAAGCGGAGCACGTGGATCTGTGCTCGGATTCAGAAGCAGTACGCACCTGGTCACGATGGTAATCATGAACCATCTCAACCAGC
TCTCCGCCACCCACACGATCAGTTGCATGCAGTTCTATTAAGTTATGACTTGAATTCGAATCGTTTGCGTTGCGCTATGGACCCTCCGACGACGATGGCA
GGTTTTCGAGACCGTACTTGGCTCGCAAAGCCTCGCGACGACTCTGGTTCTTCTCGAGCCGCGTTTGCTGCATGTGCACCTTTCGAACTTCAATTGATTC
CAGTCTACCAGGACAATTCACCTGGTTGGAGGACCACTCGCACGTGTAGCAGTCATCCATACCCGATCATGACACGGGTCAATTCTTGGTGCTCGCGGGC
TACCTGGGCCGCCGCCGCTTCCTCCTGCTCTTTTTCATAGTGCTACAAATCAATCAATGTCAAGGCGACTCATCGAGGCATGCATGCATCATCCACGCAA
TAAATTAGGACATACGCAGCACCTCGCAATGGACGTACTAGTCGCAAATTCAGCGCGCATTGCAGTGCCGCGAGCCACTGATCCCGGCGTGTAGGAGTCG
GCGCGTTCAACCGATGTTGCTGGGATGGTGTAGTCACGTACAGCCCATTCAATCCCACAGGAACAACGCTTGAGACGGCGTCGAATGGAATGGCCTTGAC
GTCACCTAACGTCGACGACGGTACGCATGTCAATGACGTTGGTGGGGCGGTTGTTTGTCTTGATTGAATCGTCAGGCGGCCGCCGGACACTGCGCAACTC
ACCAGAGAGGACAGTCGTGGACACATTGATGGACTGGTACTGCAGCGTGCCATCCACCCATCGCACGAATACCGTGCGTTCGACGAGGAATCCTTCGCAA
CGATTCATGCGTGAACAAGATGGAGAATTATGAGCAGAAAGGTACCGTATTTCACAAACTCAGCACCGGCCTCGATCAACGGCAAGTGCTTGCCGTAAAA
CTCGTTTTCACGCTCGGCGGAGGCCGCGCAGGGACCACACAATCGAACGTCTGTCGTGAGCCCGAGTTTGAGCACTTTGCCGACGTGGTTCGAGCATGTC
CCGCAGAACACTGAATTCAAAGAGAGCAGCTGAATGAGTTCGTACGATGCGCAATTGCACCTACCCACCTCCACCACACCCTCGACAATGGTGCTTACGA
TTGAATAGATCAAAGTCGTCATGACAAGCTGCACACGACGGAATGGATTCGTCCGATACCCATATCGGTGGCGTGTCGTATGCTCCCAGCACGTGCTTGG
ACGCGGTCGGCAGCATCAAATTGTCTATCTCTGGGATCGGTTGTCGATGATGCATGACGCCAAAACTGTTGAAAGGATAGAGAACGTACGGAAGGAAGTG
TGTCTTGACGACGACGGTACCGCAGTCGTAAGCGCTTCGTCGTCGTTGCCAGGATTGAAGCACCACATGACTTCCTCCGCCGGTGACGATGAAGAACGTG
CGTTGTCGCAAGAAGTGCAGAAGTTGGTGATCCAAGGAACCTTTATAATATTATATTGATAATGTTCAACATGTAGTTTGCGAGGGTGACCCGTTGCACC
GTGGTGGGGGATGCGACGGCGACGATGATGGCGGGCGAGGGCGCCGCTTCATGTTGAGGAGAATGCCATCCATGTGCCTCAAGGCGTCGACGACACCCTG
AATCGCTATACGTTATCGTCCGTGAAGCAAACTCCAGCGCTGATGCCTTGTATAAGGTATCGGGGGCCGTGAGTCCGCAACAATTCACGCGTTGACTGCT
TTCGTGCCGATCGTAGTGAGACATCTCTCGTGCATGCTCCTCATGCTTTGTGCTAAGCATGCGACGACGTCCCACCTTTGGATGACGGGCGTGTGGATCC
TTGGTCTAGCAGGTTTGCACAGTCGCAAGGATCGGAGTCCAAGACGTCAAGATGTGTCGATTCAGGGTTCCTGGAGCCTGGGATCTCAATTCAACGCACT
GTACCGTACACTTTACGTACAGTATACGGTAAAGTTTACCGTAACTTGTTTGAAAAATCGAAGTATTCACGAAGGTCGAACGTGTTCAGCGCGACTACGA
CGCCCATTCTTCGATCCGCCGACTCGAAGGCGAAACAACAACACCAAGCATGGCAAACACGATCGCCACGTCGGACGTCCCCGATTCCGTCGTTGTCGCC
GTAGCTGTGGTCCTCATCGTTCTATGGGGTATAGTGTTGTTCATCTTCGTCACGAGTGTCCGCATTGTCAACCACGCAGAGGTCATGATCCTCGAGCGCT
TCGGTCGGTACAAACAGACGCTGTTGCCGGGTCTCCACATCATCGTGCCGATCGTCGAAAAGGTGCGACCAATTGCGTGGCGCCACCGCAGCCGTAAGAT
CACGGACGGCGACGCACCTGTCATCTCGGCAACGACCGAGAGAGTTGACATGCGCGAGCACGTGATTGAATTCTCCCGCCAGCACGTAATCACCAAGGAC
ACGGTCATGATCGACATTGACGCGCTCGTGTACTTTCGCATCGTCGATCCCCGCTTGGCCGTGTACAAGGCGCAAAACATCCCTGATTCGGTCGAGTTGG
TCACCCAAGCGACGCTGCGCAACATCATTGCCACCATGACGTTGGATGACACGTTCTCATCGCGTGATGAAATCAACTACGAGTTGCTGAGCAAGGTGTG
TATCTGAGAGTGACTTGCTCAAGTCGTCAGCGCCGTGTAGGTGAAACA