Description :
From Genome Similarity Track
Location :
Scaffold_60:26360- 28432
Transcript NameFunction/comments
Aphas_H257_14811cell cyclerelated kinase putative
Aphas_H257_14812WD-repeat protein, putative

Sequence
2072 bases(100 bases per row)
AATGAACGGCTGTGGAAGTGGCTCTGTCCAGAAGTACGCATGTTTCAAGGCCTATATCTGTTCGTGTGAGTTGAACTGTTGGGGAAACAAGCAGCCCGAC
CTCGGCTGCCTCGAGACGTTTGGACGGATCGTAAACCAGCAAGCACTTGAGCAGGTCCAATGCTGACTCCTCCACGTCTGGGAAGAGCGACGCGAGCGGC
AACGGGTTGAACGCGGGGAACGAGACCTTGTGGTAGTCTGGGAGCGCTGCCATGCCTGGCCAGGTCGGGGACCCCAGCACTTGCATGACACGAAATATCT
GGTCGATGTCGTTCAATCCAGGGAAGAGCGGCGCGTGCTGCAGGAGTTCCGCAAAGACGACGCCGACAGCCCACATGTCCACTTTGTGGTCGTACGAACG
GGACCCAAACAAGAGCTCCGGCGCGCGGTACCATCTCGTGGCTACTTGATGGGCATACTCCCGCGCCGGGCCGGTGTACACTGTTGCGAGTCCAAAGTCG
CTCAACTTGAGCACACCATGTCGATCCATGAGAAGATTTGATGGCTTGATGTCCTAGAAAAGTAATGACACATACACCTGTTGTCGGACGAAAAGGTTTG
AATTACGCGGTGGAGGATGTGGCGACCATGACAGCACTCGACACCTTGGAGAAGCATGAACATGAGGGACTTTATATCTTGTGTCGACAAAGCTGCGGTC
GAGTGCGCTAGAAGCTACGGAGAGATGTGAGAATATGTGGAAATATAGGACACCCACATGCGACAGGTCCGTCTCCATGTACTCGAGGACGAGGCCGACG
CTGGCCCCTTCCGGGACGACATCCACCAAATGCACAATCTACGAACGTGTGTCATATTGCGATACGTAGTTGTCGTAGCTCACATTGGGGTGATCAAGAT
GATACATGGCTTGGATTTCATTGAAGGCCGCCGCGGGAATCGTGTCCATCTTGGACGCGTCTGTTCCCGTGCGGATGCGCTTCAGAGCGAGCACCTGCCC
AGTGGCAATCTCACGGATTCGATACACTTCACCAAAGTTTCCGTGGCCTAGTCGTTCCAGGAGCTCGTACTTGTCGTCAAAGCCGCGGCGGCGCGGACTT
TCCATCGAGTCGCTTGAAGATCGCATTGGAGTTTAACGTGCGATGACAAAAGGTTATATTATTCTTGCATCGAGATGCAATTTAATATATTGAATGGTAA
TTTCAGTTTACACTTTTCATGAAATCTTCACATTATTATAAATTAGGACAACTACTGGTATGAATTATTGAAAAAACACTGTCATAATTTGCCATGGACC
ATAGATTTAACGCTGTTTAACGTATATTCACGCATTTAGGTTTAATCTCACTATTCATTTGCAGCATGGGATTCGACGACTCATGTTCCGCAACAACGAC
GACGACGCGAGTCCTGGACATCCAAAGTGATTGGCAGACGACGGAAGATGATTCCTTCTGGGTGAGTTCCTCGGACCGTGTAGTGCTCACGTACCCCGAT
CCTATTGCTGGCGCCCACGTCCTTGCCCACGGATCCACACCCACGTCCATGCACACTGTCCACAAAGCCGACGCGTCCACGGCTGGAATTCCGTCGTCGA
CGTACCATATTGCCGACCAGTCTCGATACAGCTTGACCGTTGCGACGGATTCGTACTCGATGTCGTTTTTCACGCCGCACACGCAAACCCCGTTGCAAGC
CCAGGTTGGTAGGTGTATCTGTGTTGCATGATGCTTCCTCCTAGTTTTCATCACAATACTGCACTCGATGGTAGCTGTATGCAGTCTCCACGAGTCCGAA
CGGGGCCTTTCTCGGTGTCGGAGGTGCCGATGGTCTCTTCCACGTCCTCCAAGTCCCCACCCACACGAGTCTGCAACTCGCGGGCCATGTGTCCGACGTC
ACGCACGTCGAGTTCTTTCCCAGTTCCCTCGTCGCGCTCACGGGGAGTGCCGACTTTTCGCTGCGCATTTGGTCCGTTCAAACGTTCACCTGTGGGGCCG
TGCTACGGGGCCATAAAGGGGCCATCTCCGGCATCGGCATACTCGGCCGCGGCCGCAACGTTGTCTGTACGT