Description :
From Genome Similarity Track
Location :
Scaffold_91:2636- 8349
Sequence
5713 bases(100 bases per row)
ACTGTAGGTTGACGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCATCATACGCCAGATTCTGCCATTCTCTATAGGGACGAGATCCCACTG
ACACATATCCAGGTCGCCTAGGGATACCACCCTTCGCCAACCATCGCCCAATTTCCTCATAGTGGTCCTGTAATTGGCTCTTGTCGCTGACATTCGTGAA
CGGGAGGTATTGTGATCGACCTGGCCCTTGGATTACTGTAGGCACCCATTTCTCGCCCCGAGTGACCCACAGTTTCTCATGTTCCAGCCACTTATACCGA
TCTGGCAGCTCCCAGGGTTCTCCGGGCTCGATCCAGGTTGTCTTATCCGCCCTTATGAACCTCATCTTCGCCCCGTGCAACGGTCGCCGTCCGCCGAGCT
GGATTCGCATCTTGTCGGGGAAACAAAGTGTCCCACCGCCAGATCCTACCTCACTCCGGCTGGTACCATGAAATCCATCCCGAGGATGGCGTCTTGACCA
GCGAGATCTCCAACCCAAATGTCAAACCAATACACCAAACAACCTTCCAGCGTGATCTTGATCCGCGTTCTCCCGTTCGTACGGTACACGCCTTCACCAA
TTCCAACACAATCTTGGATCCGACTCCCATCCACTTGGCACCCAACCTTACGAGCAAAGGCGGTATCCAGTATAGACACCTCGGCACCACTATCTAGGAG
TAGGATTGCTTTTTCATTGTTGATCTTGCCCCCTACCTTGGCTTGTCTGAACTACGTTCCTGGGGCATGGTACTTCCAGTATCCGCGGGACTCCCCTGTT
AGCAAATCCATGGATCCAACATCCTCAGATCCACGGGATTCAGTGACCTGACAGACCTTAGGTGGATCTGCAGTGACCTCACCCTTGGTAGGCTCACACC
ATCGACCATTTTGGTGTTTCTCCCAATAACCACGTGACTCTCCCCTTTGTAGATCCAGGGTGGAAGAGACTTCGGATCTGGCAAACTCATCCACTTGGCG
CAAACTAGAAATCTTGGCAACTGACACTTCATGTAGATCACGTGTATTCTCGACTGGATCTAGGGGCCTGCTACCTGGATCTAGCGATGTCTTGTTCACA
AATGCATAAATGCAATACCTAGAACGCTCGGCGCGTACCGGATTCAACCCGGCGAGCGTCTTAGTTTACCATCTTCTCTGGCACTTCTGGCAACATCCCT
ATGTGCTTGGCTAGATCAAACCATTGGCGGATCTGGCTGTAAAATTCTTCCATCGGGCACTTGCCGGCGTCGTGGATCTCGCCACAGCCGCGACACACGT
CGAAGCAATGATCCCCGGGATGACCCTTCTTGCCACACTTCTCACAAACCAGATGTTTCCAACATCCAGACTCTGCTTCCGGGATCCATGCTGCGAGCAA
CTGATTTGTCCTGTCCCGTTCATGAAATCTCGGGATCTGTACATCCCACGGTCCCCGGGTACGGTATCCCCAGTACGAGAGTTGTCTCCAGTCTTCGTCG
TATAATCGTTGGGTGCAGTGAGACAAACTCGGCGGCAATCTTCTGGGTCGGAGTCCGAACCATCGGATCCTGACTCAGTTCCTGAGTCGGGCGCCGTGAC
GTGGTGGACACATCGAGCTGGGCCGTGGGTGTCGGAGCTTTTTGGCGATGCTTGCCGGATCCGACCGCCGCCTTCTTCTGGCGGTATTTCGCGCGATCCA
CAGCCCGCAGCACTTCTTCAAGCGCATCTGCGTCTGGAAGACGTAACAAGGTCAGTCTATCGGCCAGGTTCACATCTCCCAACGTATCGATGAAATGATC
CACATGTTCCCGCAGTACCTTGGATCCCCCATCCTTGATCTTCAACTTGGCCCGTAGACCGGCCACATCCGATCTGCGGCGAACATGGTAGTATTGTCGT
GCCACCAACACTCCCAATCCACAGTACTGGGTCGGGACACTCCGCAACAAATCTGGCCACTTGTTCCTGGTGGACCTGCCCAGCTGCCGATACCAATTCC
TGGCTGGACCCGCTAGCAGATCCGCAAAGGTCAGACACTTCTCAGCATCCGACGCTTGATCTCGCATGAGGGCTGACTTGACTTTGCTGATCCATGTTCG
CGCTCGGTCTTCGTCTTGATCCTTGCCCGTGAACTCTTTCAGATCCGATATGGCTGATATTCGTACCCTCTGGATCATAGACGATTCATCCGTCCCGGTT
GCAGCTGCTGCTCCCGCCGCTGGCGAGGGGGGTGGGTCGTCCAGATCATCTGAATCGAACTCATCATGGGAGTTGTCTCCGTCCACTGAGTCCATCTCCA
CGTCTCGTGCTCCATGTTCGTGCAGCACTTGCGCTTGTGGTACGGGCACTCATACCCTGTTCGACCAGGAAACGACTCATCGCAGCTTCGAAGTGTCGCT
GCAGGGTGCCCGAGGAGGTGTCGGAAGAGTCTGTAACCGTCTGGTCCACTGGCGAGACAGGATCCGTGAGGCGATTACCTTGAGCCCGATCTGACGATAG
GCCTCTTGCTGGATCTGGCTCGAATATGGTTGGATTGTATCAGATCGCGGTACTGGATCCCGAGTCTTCACACTCGAGGGCGCTTCCTGTCCTCGGATCC
TCGCCCGCGCTTCCAGCATGGATGTCCCGGAGGCTCCCAACGTAATGCGCCGGGGCTCGGACGACGTGTCTGACCCATCATCAGCCGCGGATTCGTAGTT
CGAGGACGCAGCTTGGCTGATCCTGGGCGACGACACTGGATCCATAGTGCGCGACCTTTCTCCGGTGATGGACTTAACACTGGCAAAGAGGTCCCGCGTC
GCGAATACTATGAGATCCGAGTCTAGCTCGAAGATGTCCTCTGCGTCGAGCACTCCAGCTACGATGCCTGACTCCGTAAGCAAACGTAATAGATCTTTGA
CTGCCACCAACTTGTTCGCCGTTTTCGTTGGTGCTCTCACCGGTTCCCTTGAATCTTCGATCTGTCATGGATTCATGATCCGCATGACAGGATCTTGATG
CAGGAAGTCGCGTAAATCTTGGTTGCGATACACAAACTCGAGATCCTTGTCGGACCAGCTCGACCTGGATCCAGCTTGGTCTTCTTCCAACGCTGTAGCT
TGCATCTTCTTCCGCGTAGTCTTACTCGTTTTCGTCTTCTTTCTCGTTTCTTCGACTAGCGGGGTTGGGTTTAGGTACGGTGTTGGCTTAACCGGTGAAT
CTGCAAATGCATACCGTTTCGCCTTCACTTCCCCTTGTTTTGTTAGCGGATCTTGACTTGCGTCAAGATCCGCAGGGGTCCCCGAGGGGACCTGGGGAGG
ATAGAGAGGTTTGTCTTCTAGATCCGGATCCACCTCTCTTCCGTCGACAGAGTTCCTCCCAAAACTTCATCGATCGGCGGATCTTGTTTCATTCAGCAGC
GTCTTCGTCGACCGACCTCCGACGACGCCTCTTCCCCTGGCTCAATCTTCACTTTAGCATCTTCTTGGGACTCACGATGAAATCTTGAGTCACCAAAAGA
TTCGGGCACGCGCACCATTGTGGTGTAGCGGGATCAGCAAAATCTGCGAGATTGCCAGATCCAACTTACCAACTGCGCCCAGACACCGACTAACGGAGGG
GGTCCCCCGATAA