Description :
From Genome Similarity Track
Location :
Scaffold_557:2636- 7797
Sequence
5161 bases(100 bases per row)
GTAATTGACTTGGTATGTTCCATGACGCGATCTCTCAATTTACTTTCTTCTCATTTCCATTCGATCGCTCCCATAATTCGTATTTCTTCCATCTTTTTTG
TCTTTTCATCTTGATCGCACCGTTAAGTCTGCGATCGTCGCACTCAATTCACATAAATCCCATTCCATCTCCATGTGCAACCTCCTTGCACCCATAGGTC
TCCTCCCCGTCTATGCACCGTCCCTGCATAGACCCATCCACTCAAGCTCTCCGATCATCGCTATTCTCTGGCTTCTTCTTCGTGCGATTGTATCACCTCA
AAACGATTCTTGCTCACCTGATCGCGATCGAACTCCTGCAACATAGCTCCACAATTTAGATCAGCTTCGTCAATCCAAGTTGGGTCGCTGTACTCCTTCC
GTTATACCAGGTACTGTTTGTGTATTTGGCCATATCTCGTCTTCCGTCCTGATCGCACATCGATGATCTTGTCTACTTCAAACTCGTCCGCGTCGAGATT
ACCCTCCCAACTATCTTCCGGCAGCAGTACTTCATCAAAATCAAATCGAGTCGCCTCATCCACATTTAATCCACCCGTTGGGCGTTATGGGAATACGCCA
ACTAGCTTCAGCTTAGACACGTGGACTATTGGGAATATCCGGTACGGCGTGATCGCCGCACTTCTCGGCCACTCGAAAAGGTCCATGCCACATATGGGCT
AGCTTTCGAGCATATCCTTCCTTGACTCGGTCCAGATATAGCCAAACGCGCGACCTGCGATCGATATCCAATAAATATCGATCTTCATTATGTCGATCGG
CTTAACCTCTGATCGCAACCTCCAGTCGTTCATTCACTACCGCCCGATCACGTTGATATTGGCGTTGTATACCATATCTCCATCTTCGGGCATCTGGATC
CCGGGGTTTGGTAGTTCCCAACGGTATGGTTGCTTCCAAGGCCGATCTTGGGTCCCAGCCGTGAATCAGGTAGAACGGTGTATCTCCTCGAATTCGATCA
TGAGCGGTGTTGATCGCATGAATCAATAGCTCTGCGTATTCGTCTCAGTCCTTTTGATTTTCATCCATGACATGCATCTTGATCGATCGAGTCAGCGTCT
GCACCATTCGATCGGCCGTACCATTAGCTTGCGGTCTATACGCCAGAGTAGCCTGTAGTTTTTGTCCTGCGATCCGATTGAATGCTCGGAAGAAATCAGA
TATAAATCCCGGCTCGCGATCATGGCGGGTTGCGTCACTCGTACCTTATCGTCTGAACACGCACTCCTCGTAATTCTCTGCGATCGTCTGGGCAGATCTG
GACGAGCTTGCCTTTGCGATCACATATCCCGAGAACAAATTGACCCACAGCAACAGCTCGGTGTTTCCTTTAAAGGATCTTGGCAACGAAGGGATGTGAT
CCATAGCTATAATCTGAAAAGGGTACGTCGATTGCATATTACCAGGTGATCCACTTCGATCTCCCAGCCTTCCTTTTCCCGTTTCACAATCTACACGCTC
TCCCACATACCGCTGCACACTTCGGTACAACCCACGCCAATGGAAATTCGCCCTGATCCGTTGATAGGTAAGGCCGATTCCTTGGTGACCACCCTCCAAA
CTTGTGTGGTAGTGGTGCAAGAAGTCTCGGTGTAACTGTTCTGGAACCACCAAACGAGCTAGTTCAGTACGATCTTCAGCTTCGGTGGCCGATCTCGGAC
AGAAGAATAGCATCCCACTTTGGTCTACTTCATAGTCCGGTGCGATCAGGGTGCACACCTTAGCTTCAGCTGCCGATAATTTAGAACGTCTCCAACCAGA
TATATCTTCAAACTAGATATCCAGTTTTCTTCGTCTTGTGCTTGCTTAATACGACCAATCCGTATCTGCTGCACAACCTCTTCCTGTAAAATCCTGGGCT
GAAAACGTCTTCTCTGGGCTTTTCGAGTGATAGCCGCTACTTTGACCGCACGATCAACTCGTTCTGGTAGTAGTAATTCGTTTAACCGATTGAGGGTAAT
CAGGTCCTGACACTATTGATCGGAAACCACAACTGTCCCTTTCTCTTGCCGTAGAGCTTCACTCGCCAACCGATCTGCACTCTGATTCCAGTCCCGCTTC
ATGTTTAAGAACTCGTGGGATGGCCACAATCGTAACCTCTCCATAGCCCTATGCCTCAGCAACTGCAGTCCCGGCGCTTTACAGTCGATTTCTCCTCGCA
TTTGACGGATCACCAAATTCGAATCTACGCAGATAATCACCCGTCCCCTTGCCTGATCGGCAAGCAAATCAAAACTAAGGAGCAGCCCTCAGTATTCTGA
TTCATTCACGGTTAGATCAGGTGTATACTCGGAAGCAACAGCCACAATCGTCCATTTCGGCAGTTTCCATATAATCGCGCTGTATGCTCCGCTTTTTCTT
TTCACCCTGGCTGATCCATCGAAACTGGCTACCAGCAGGTTTTAATTCACACCTACTGTGGGTGGTGGCATGCTTATCGTCTGTCTTGGCTGCTTCCTCG
GGGAGATCGCAATCAATACTTCATCTACTTCTTCATGGGGTGTTATACTTGCCGCAAGCATACCGAGTATTTCATCTTCTCCCTTCTCAGATTGCCTAAC
TTCCAACGTTCAGTTCGATAGTAAAGCAGCCCATCTTTCCAATCTTCCGTTGAGGCCGGAAGATTGTAGTAACCATGCTAGTGTCTAATATCGCGTAAGC
ACCGTAATCTCACGGGATACTAGCATAGTATAACAGATATCTAGCATCCGGAGGAGAGCCAACACTTCTTCTCCACCATCCCGTAGTTGACCTCGTTGGG
CTTTAGCGTACGACTAGAGAAAGTGACAGGCCAATACACACCATCATAATCCTGAAGCAAAGCAGCTGATACATCCCACTTACTAGCATACACCACGATC
ACAGGCGATCGATCGGGATCGAAATGCTTTAAGATTGGAGTTGTGGCTATCTTAGCCTTTAGCAACGTGAATGCAATCATTGACTTCTCCCATAGATTCC
TGCCCTCGGGATCGCGATCGTCCCCCGCAATTGGGTACCGATCGACATCGATCTCCGGTTTTGGGTACAGATCGCGATCTCCCCCTGCACTCCCTTCGCG
AATAGCATCAAGTCTTACAGCAGAGGTAGGTTTTGGAGCTTCACTCACGCGGTTGATCTCATGGAAATCTGCTTCACGCAGTTCGTACAACACTGATGCG
TAAACTGCGAAGTCTTCAATGAATCTACTGTAATAGTTGAGACTTCCCAAAAATAACTGCATCGCTCGCAGCGTCAGAGGGAACAGGATGTTCACGAACG
ATCCCAGATCTTTCGGATTAGCTTCCAAACCTGCGAGCGAGATTTGATGTCCCAGATAATTCAACCTTGCGACGTCCCCAAAAACGTTTGGCCAAACTGA
TCGACAAATTCCACTTATCGCACACCTCCAATAATCTCTCCACTTTCTCGCACAAGGCCTTCCACGACGTAGCTGGTACTAATATGTCATCAATATAAGA
TCTTCGACCCACACTGATGTTTTTGGATCAGTATCTGGTTCACCATCAGTGAAGACATCGATCAACTTCGGCGATCCCGCCGTGGTCGATTCGGATTTTA
CGCCAATTTCAAATACCCATATAGAGCGTTATCGGTCAAACATTGGTAAATCTGTGGAGCATTTTTCAACCCGAAAGGAATCCGTAACCACTCAAACAAC
CCTGAGGGTATGATAAAGGCGGAAATCGCCCTTGCTCTTTCCGTCATCTCCACCACCCAAAAACCACTCGCCATGTCCTTAGAGCAGTACCACATAGTTT
TATCCATGTCTTGCAACAGTTCGCTGATCAGTGGCATCGGATACACCATCAACCTAGTGTGATGGTTTAACCGCCTGTAATCAATACACAGCCTTATATC
TTCTCCGTTTTTCTTGATGATCACCACTATGGGGGACGCCCATGGTGATGTAGATGGTCGAATGATCTTGGCCGCCAGTAATCCCTTGATCAGATCGGCG
AGTTTTTCTCGGAACTTTAGTGCTACCGGTCGGAACCGTTGTGCGATAGGGTTAGCTCCTCCCACGTCGACGTCACAAACTGCCCCACACGCCGCAGGAG
GTAGAGTTTTACCCTCTCCAATAAGTAGATGCCGGCTCTTCCAAATCATTTGTCGCAACTTCTCTTGATCCTCGGTTCTTGGGGTGCCGGGATCGCCTAC
TTGAATATCATCAATCGTTATTTCTTGTGTGGGCGTAACCACTTCGGGAAGAACCGCCATGTGCTGATCCACATCTTCCGCGAACAACTTGCCGCCATCA
TGGTAATACATCGGTGTTGATGCTAACTCATCTCTCGTCGTTTCTTCGTCAATATTGGTATTGCCCACTTTTTTCGTCCGTCGATTGGCCTGGTCTTGTA
ACTCATAATCTTCGCTCTTAATCCCGTAAGGCTGATGGCTGGACTGTTTATGGACTGGATCAGTTCCTTCATACCCGTTATCCTCAATTTCGCTCGATTC
GTATCTCGTCTGTGTCGGTTGATCTCTAACTCGATCACTCTCATCCCTGGTTCCGATCACATCGATCACCATTGGAGGTCTCAAGGTCTTCTCCTCTTCC
GCAGGTGTGTTGATCTTCACCACTTCGTAGTCCTCGAACAGTCGATCGGCCTGTTCCTGAAACTCACCATCTTCAATTGCGATCGCGTCTGAATGATGGC
TGGACCGTTTGTGAAACGGATCATCTGCCTCATGTCGGATCTCTTCCGTCGCAATCACCTTCACGCCTTCGATCGCTTCACTGGGATGATCTCGTCCTCG
ATTGGCGTCAACAGTCCCCTTGATTTTGTAGATCGCAAAAAGTATTTCTGTTGATCATTGATCCTTTCTCGTCAAGTGACTTCCGTCCATGGTTTGGTCT
TGACTCTCACTTCCGTTGGTCGTTTCTTGGTTTGGTTACGACATACTCTTCCCCGATATTTCTGTCGTTTTGCGGGGTAGAATTCGATTGGGCCTTTCAT
AAACAGGATGATCCACCAACAGCCCTGCATACTGTTCCAGAGTTTCTTCCTCTCGTTTCGTAGTCGCTTCAAACGCTAGCGTTTGCCATTCAGTGCACCG
CCGTGGACCAATCAATTCATATCCCGGTGATCAAGGTATCATGTCGGATGCGATCCACAAA