Description :
From Genome Similarity Track
Location :
Scaffold_33:263583- 264669
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G010925Similar to FAD3: Omega-3 fatty acid desaturase%2C endoplasmic reticulum (Glycine max)

Sequence
1086 bases(100 bases per row)
CGCACGAGCTCCGGGAACGCCTGCGCGAACGCTGCCGTCGCCTCGTTCAGCTTGTAGTGCGGGATGATCGGAAACAGGTGGTGGATCTGGTGCGTGCCGA
TGTTGTGGCTCAGGTTGTCGATGAGCGCGCCGTACGAGCGGTCCACGGACGAGAGGTTGCCCTTGACGTACGTCCACTCCGAGTCGGCGTACCATGGCGT
TTCCTCGTCATTGTGGTGCTGTTCCAACACATTCACAGCGTCAGCACATACGTAAATAGTAGACTTTGCACGGGACGTACCAAGAACGTGGTGACCACGA
GCATCGTGGCGAACACGAAGATCGGCGCCCAGTAGTACAGCGCCATGGTCTTGAGGCCGTAGACATACAGCGTCAGGTACACGTAGAAGCTGAAGAAGAG
CGCAAGCACGGCCAGCGAGATGATAACGGCAGACACGCGACGCAAGTGCTTTGGTTCCCACTGCACGAGGACATCAACGACATTGGTACGTAATGAGACC
AACCGCGTTTCAATATAAAGGAAGCAATGCATGCATGTTCGCGTACCGGGTTGAAGTGGCGAGGTGGGGAGCCAGCGAGCAGGTACACGAACCAGCCAAA
GCCGAGCGTGAGCGCCAAGTGGCGCTCCGCGGGCTTCGAGGCTTGTTCGCGGTGTGGATAAAACACTTCGTCCTTGTCGATGTTGCCCGTGTTCTTGTGG
TGGTGGCGGTGCGAGAGCTTCCACGACTCGTATGGCGTAATGATAATCGAGTGGATGAGCGTACCGACGACAAAGTTGAGCGTGTGCGAGCGTGAGAACG
CACCGTGGCCGCAGTCATGGCCGATGGTGAAGAACCCCCAGAACACGATACCTTGCAGCAGAATGTACCCCGTGCAGATGGCTGCATCCATAATTGCAAG
TTCTTGAACAATTGGAAGCGCACGCGCGTAGTTGAGGCCCAATGCGAGCGAAGCAGCAAGCACGAGCGAGCGCACGGTGTAGTAGAACGACCACGGGACC
GAGGCCTCGAAGCAGTGCGCTGGCAGCGAGCGCTTGATCTCCGTCAGCGTCGGGAACTCGTACGGCGCAGCAACAGTGGACGCCAT