Description :
From Genome Similarity Track
Location :
Scaffold_63:263567- 265633
Transcript NameFunction/comments
Physo_138440reverse transcriptase

Sequence
2066 bases(100 bases per row)
TGCATGTACCGCATTGTTGAGCCGCGGGTCTCGATCAGAGACAATGGTCTCGGGCAGACCGTGGTGTCGGAAGACACAGTCCATGAACAGGCGAGCGACC
TCGTCGCCAGTGACGGTGCCACGAACTGGAGCAAAGTGGACCATCTTGCTCAGACGGCACACGAAGGCAACAACACCAGTGTTGCCACGGTCATCGGCCG
GAAGTCCGAAGACAAAGTCGAGACTCATCGACTTCCAGCAGTCCGCTGGGACCGGCAGGCTCTGCAATGGTGCCGAGGCGTGACCGGCAGGCTTCACGCG
CTGGCACGTCTCGCCCGTACGGACGTAGGTGGCGACCCACTTGTACATGTGACGCCACCAAAACATCTGCGAGACAGACGCGTACGTCGTCTCACGGCCG
AGATGGCCACTGGATGGAGCGTCGTGCGCCTCCATCAGGATGTCGTACTTGAGATCCTCGTCGTTGGGCACGACAATACGGGGAGGATCCTCGGGCTCGA
CCCTATAGTGGAGCAAACCGTCAGCCCACTCATAGCGGTGCAGCCTTGCACGTTGTCGGGGCGTCACTCGGCCTTGGCTTCCGAGCCAGCGGCCAAGAAC
CGCACAAGAGGTTCGAGACTGGCATCGTCTCGGTACCCCAGCCTGATTCGATCATACAGATCCGTCGTGACCCGACTAATATGAGCAAGCTCGTAGTCGG
GTCGGCGCGACAGCGCGTCGAAAAGCACGTTCAACTTGCCCGGCTTGTACTCGACACGGAAGTTGTATTCCGCGAAGAATGACAGCCAACGCGCCATCCG
CTGTGAGAGATGCGGCGTGTTGACGGCAGTCCGCAAGGACGCGTGGTCTGTATAAACGACAAAGGGCGTCGAGCGCAGGAGGTGCACTCGGAACTTGACA
AGAGCGTACTTCATGGCAAGTAGCTCCTTGTCGTGGACTGGATAGTTCCGTTCGGCTGCCTTGAGCTGCCTGGACTGGAACGAGATGACCCGTTCGCGGC
CTTCATCGTCGGCCTGCAATAGCGCACAGCCAATTGCGTAGTCAGACGCATCACAGACTACGCTGAAAGGCTTCGTCTCGTCCGGCAATGCCAGGACTGG
CGCGCGCTGTAAGCTCGCTTTGATGTCGTTAAAAGCATCTTGATGGCGACGCTCCCAGCGCCAGTCGACATCCTTCTTCAGGAGATCCGACAAGGGCCGT
GCCAGCTCGGCGTAGCCTGCACTATACTTGTGCAGGTAGTTGGCGAGGCCCAACCACTGTCGTAGGTCCTTCTGCGACCGAGGTGGCGGCCAAGCCGCGA
TGGTTTTCACCTTCTCCGGGTCCGTCCGGACCCCGGCGCTGCTGACGAAGCAGCCCAGGACCTTGATCTCCTCAGCTGCGAACACACACTTGTTGATGTT
GGCGTACAGCTTGTTCGCCCGCATGACTTCGAACACACGTCGAAGGTGCTGGAGATGTACCTCCATGACCGTCTGGCCTGCCTCGGCACGGCTGTGGACG
AAGATGTCGTCAAAGTACGTCTGTGTGAACGCACGCAAAGGTCGGAACAGTTGTGTGACCAAGCGATTGAACGTTGCCGGGGCGTTAGAAAGCCCCTGAG
GCATGACCAGCCACTCCCAGAGCATACCGCTCGGCGTGCTCACAGCCGTGAGTGGGATGTCGCTTTCGCGCATCAGAATCTGGTAGTATCCGTCCACCAG
GTCCAGCGCGCTATACAGCGTGCAGCCGGCCATGTTGTTGAGCAACACGTCCTTGCGCGGGATCGGTGTCTGCGCAGGCACTGTCGCGCTGTTCAGCTTG
TTATAAGCATGAACCAGACGCCACTTTCCGTTCGGTTTGCGAACACAGAAGGTAGGCGTCGAGTGCGGGGACTTCGACTCCCGCACCATGCCTGCCTTCG
CCTTGGCGGCAAAGAAGGCATCAATGACTTCACACTGCTCCCGGGGAAGAAGCCATTGCCTCGTGACACAGTACTTCGTGCCCGGCACGAGATCGATCTC
GTGCCTGATTCCCCTGTCCGGAGGGAGATTGGACGGTGGATCCTTGGACACCGCGTCCTCAAACTC