Description :
From Genome Similarity Track
Location :
Scaffold_1:2635018- 2642878
Transcript NameFunction/comments
Phypa_INRA-310PPTG_00679hypothetical protein
Phypa_INRA-310PPTG_00680hypothetical protein
Phypa_INRA-310PPTG_00681hypothetical protein

Sequence
7860 bases(100 bases per row)
CGTCTTTGCTATTCCGGGCACGGAATTAAGTTTGGCCCACCCGACGACGCGCTACAGACGTACCTAAGCAAGATCGAAGCTCGAGCGCCTGGATTGCTTA
ACCAGAACGCTCATCAACTCTCACTCAAGACCAACCTCTAAAGGAAGCGGCAAGCGCGTAAAGGAAGGAAGGCACCATAAGATGTCCCCGGGCCAAGACC
AACATCGGCCCCCAAGACCGTCGATCTTATATCTTACTATTGACAGCTCAAAACCGTAATCGACGCGGTGAGTAGACGTATCCCCGCTGCTGTCAAACGT
CCCGCTGTATACACAGTCCAAGAAACCAGCCCAAGCGTCGCTTCCGAGATCATCCCAAAAATATAAGCCCACCGACGGGTACACAAGATGAGCATTTCAA
CTTCACGGAAGATCGGAGTACCCCTTCCGTTAGTTGGCAGTTCGGGTGCAGTGTGCAAGAGGACCTCAGCGATCAGCAATTTTTGCAGAACCACTTCGCC
ACAATGGTGCGCGTGCCCGGATCTTTGGGTGCCTCAGGATACCACCGTGAGTCACCAGATGAAGAAGCGCAAGCTAAAATTGGACTAGGGAACGAAGCGC
CGACGGACATTGGATCACCGTTGACTTCACTTAACCAAGGTCGATCAACAGATCGTTGGGAGGAGCTCTACCGACGGAACAGAGGGAGGACTGGCGACAA
ACCTAGAAGAAAAACCTCAACCTCCTGCCAAGGTCCCTTCGGGGACCGCTGCGGGTTCTAATTCGCATCAAAACCCGCTGGACGAAAGTCCACTCGCGAA
AGCCGGGAACGTCTCGTCCAAGCAACCGCCTAGCTCAAGATCGACGGTAAAGAAGAAGCCAGCCAGATCGAAGTCCTCACGAAAGAAGCTGAAGGCACCA
GACTCGACCATCGACGGTCCCGTCGATCTTACGTCGGCTTGGACGGATGAACAACTCGAGAACGTGTATCAAAAGAAGTAGCTTCACGCATTTCTAGCCG
AGGACGCTGTGATGCGCATCCTCCGTCCGAAGCTGCTCGGTGATCTGGAGGGTCCTGTTTCTGAACCGGCCTTGAGATCGAATAAGTTGGACAACGTAAA
AGCTACGCTACAGTTGTTCAAGAAGTCCGGAATTGTTACTGAAGCATTTGAGGCTAATGATCTGTTCGATTTTAGAAGAGGTCATCAAGGCTGCCCCAGG
ACGCTGCTCGGGTTGTTGAAGCCGCTGGTGGGTGGAGTCCACAAGGTCCCTATGAAAGAAGGACCCCCGACTGATTTTCCAGGGGACGATCGCGACGAGT
CGTCTTCCCATTATGAGTCTTCAACAGAGGAGGTGGACACCGACAGTGTCGATGACCCGTCACGAATGACTCTAGGCCCATCCGGAACCTCGACGCTACG
AAATCGAGCCGCCCAGAAGGCTGCAAGTTCACCCACTGAGAGAGGCTCCGCTGTCGCAAGTGTAACGCGCTTTTCGCCGGAGAAGCTGGGGTCATTCTTT
CAGTCGGCGATGGGGCGATTTCTTGAAGAACAGCGGACAGCGACGGCGCCTGAAGGTCCGACACCCACTGGAGTCCAAGACGTAGAGATGGAGTCGGTTG
GATCTCTAGATCGCTTTCTCCTTCCAAACGAATACGACCGCGATGATCTCGACCTCATCGCGCCCCGACGTGCTGCCGTCGCAACGACGTCTACAGCGAA
GTCCACAATTGCCCCACGTATTCGGGTGTCAGCGATGTCGGAAATGAAGGCGTTTTTGGGAAAGGACGGCGACGAAGATCGAGCCCGATCTTGGTTGAGC
AAGGTTAAATCAGCCTTTGTGCGAGATCAAGCGCCAGGTGAGGCAAAGTGCCTTGTCTTGGCGATCTCCTCGCCGGACCATCTCGAAATTGGTATCGACA
GCTAAGTCGTACGACCCGCAGCACGTGGAAGGACTTGCTCTACAGCTTCCAGACGCAATACTGCGGCCATGGTGTTTCCGTCGCAAAGCAATACTACCAT
GCCCGGAAACGATCCGACGAGTCGCCGCTGGAGTATCTGAATCGCCTTAATGTCGCAGGTCTACGCGCTCGAATCCAAGTCAAGGACGGTCCGTCGCAAG
TCCGCCGTGAACATGTTGATCACTTCATCGAGACGCTGGACGACCGGGATTTAGCTGATCATCTCGCACTTCTGAGGATTCCCGATGCAGGTGCCCTCGA
CGAGGTGTTGCGATCTCGCCAGCGTGCAAAGGCACGACAGATCAAGTCGGTATATGGCTCAATCAAACCTCGCCAGAAGCATCCCAACGCGACCGTACCT
ACGCGTGCGGTTAAAGCGGTCCATGCTGCTGAAACCAGTAGCGACTCGGAGATCGAGACGTGTGAAACAGATGATGACGAGGACCTGCACCGAGTGTACA
TTACTACAGCTGGGAACCACGATAAACGTCAAGATCGAAGCCCTCCGAGTCAAGATCGACAAGAGATCCGTGATCATCCGGGAGGCCAATACCCAAGATC
GAAGGACTTGGGCACGGTGGCCAAGCGCTGCCCGCACTGCGGATCGAAGAAGCATGACGATCTTGGCTGTTGGGGACTCTTGACGTGCGAGCAATGCGGA
CTTAGAGGCCACCCGACAGACCGATGCTTTTTCGTCTGCAAGGCTTGCGGAGTGATTCATGAAGCTGGGGAGTGTCCAATGGAAGAGTTTTACAACCGGG
TCCGTCAATTGTTCAGCCCCGACAAGCTTCGAGGGATGTTTCCAGAATCTGCGGAGAAGATGTTAAACTAGGACGCTCGCCGGGTTGGAATCCGGTACGA
GCCGAACGTTCTAGGTTTTGCATCTATGCACGTCGAAAAACGACCGAAGTTATCAGTTGGCAAACCGATGGCTTCTATCTACAATATATGTGATCTTCAA
AAGAACTATATCTTAGCCGTGTCAAGTCTGTGTGAGATCTACGAATTCGCCCGTAGTAATGACCCTGGACATCTTGCCTGGAGAGTCGCGTGGGTACTGG
AAGTACCATTTACCAGACAAATGTTTCAAGCAGGCGAAAGCTATGGGAAAGATCAACAACGAGAAGGCGCTCTTGTTGCTGAATAGCGGCGCCGAGATGT
CTACTTTAGGCGCCGCCTTGCTCGTAAGGCTGGCTGCTATGTTGACTAAAGTCAGACACTAGAGTGTGAAGGAGTTGGAAATTCTCCGTATGCAACGCAT
GGACGTACACGAGTCAAGATCACGTTGGCTGGAAACTTGGTGTATTTGTTCGACTCTGGGTTGGCCCGCCGACAGGTGGTCAAGATCTATTCCTCGGCAT
GGATTTCATGGTAACTGCCGGAATTCGGCTCGATCTTGCAGATGGCTCGTATTGCCTTCCTGACGATGTCCGGATACAGATGTATGGACGGCGGCCGCCC
TACGGAGAGAAGATCGACAAGATCAAAATTCGTTAAAGCCTCAGTATTGGTCCTTGGTGATCAGGGGAGATCCAGCTACGCCAGCGATCTTGCGATCTCA
TGAAGCTGTGGGCTACGTTAGGCGACCGCTGGGTCCCTACCTTCGTGCTGGGCCCGGGCAAGAAGTGCTACCTGAAGATCACCAATGCTAGTGACCGTGT
GGTATGGTTACAAGAGCACGATCGAGTGGGAATGTGGTTAGCGGAAGGTCGAGTACCGCGCTTACCGGGATATGTCCTGGTCGGGTCGAGACGCCATGCG
GAGTGGCAGAATCTTGCGTACCAAGCTGCGGCGGACGAGATTGACGACGGGCCTGAGGTGGTAGACCTACCAGGGCCGCTGTAGAACGGCTGTCGTACGC
CACGCCGACCAGGATCCTGCCCAGACCAACAGCGATCTCGCCCGAGTCGACGAAACCACGGTCTGGTATGGGCAAGACTATAACCGCGGTTAGGGTGTGC
GACAAGGCAGCGAAGAACACTGACGAAGCCAATCGAAGAAACACCATCGAAGCCGGCCAAAGCAGTTTGCAGTCCATCGACCGGACATCCGACGACACAG
CGTGTCACACGCAGAATGAGTCCACCCCATCCCGTGATCAAGAATTTTCTGCAACAGAGATGCGTAATCGACTCACTGAGACAGGCTCGAATCAGATTAA
TAATCATAATGAGGCGGGGTCACTTCGGATTGGTAATCAAGATCGACGCGCAGAGACGAGTTTCGGATAAGATCGACGTGCAGAGACATGTTATGAACAA
GATCGACGGATGTAAGTTGAGCAAGAGCGACGAAAAGGCACAGGCGCTAAACAAGATCGTCAGATGGAGGCAGAGGCATATTGGACCCGTCATCAAGATC
GTGGAGCAGCCCCTGATCTTGGGGATGAGGAAGTGTGTATCAGCGAAGGAAGCGACGTCTACGCAGAAGACGCCAATAATAACATGGCAGTCCTTCCAGA
CGTCGCTGAATTAACGGAAGAAGTGAAGATCGAGGATGTCCAAGTAGGAGATCCAGATTACAACACACCAGAGGCAATCGACAGATTGAGGCGAATCATC
TGGCGGCGTCGCCACCTCCAGATCGGAAAGGGTAACGCCTTACCGCCAGCTGCGGTTGGGGTCGTATGCGACAAAGATGTGGGAAACGCCAAGCCCGTAG
CCCAGCGAGTTCGAAAAGTCGCCCCACAGTTTCGAGAGAAGCTGTGCCTGCTGATCAAGGGTCTACTATCCGCCAGGATCATCAGCCATTCGTCCTCGCC
CTGGGCCTCCCCCATAGTCGTTATCATCAAGAAAAACGGCGTGGACATCAGGCTCTGCATCGACTATCGGCTGGTGAACAGCCTAACGCGGTTAATGGTG
TATCCAATGCCTTTGATTAATTACCTGCTCGACGATCTCGACAAGGCACTATGGTACTGCTCGCTGGACATGGCCAGCGGCTTTTGGGTCGTGTCGATGA
CAGATCGAGCTCGAGCGATCTCAGCGTTTATCACGCCTTTTGGACTATTCGAGTGGGACCGTATGCCGTTTGGACTCAAGAATACTCCTAAGATCTACCA
GCGACTGCTAGACAACGTTCTATACGGTTTCCTCAAGATCACGGATAACCAAGATCGTGCCGACAAGACCGACGTATTTGAAAACGGGGAACCCGATCGG
AGCAAAACGTCCTCGGTTCTTAGACGTCGATCTTATATTGATGACATTCTTGTGACGGCGAGATCGTGGGACGAACTGTGTGAGAAGGTAGACAAGTTCT
TGGACGTGTGTGCTGAGTGGAATTTGTCCATTAGCGTGGCGAAGAGTGTCTGGGGACGGCGCAAGGTCGACTATATTGGCCATTGTGTTTCCGCAGACGG
ACTTGAAGCCAAACCGAAGGATCTGGCTGTTCTTACTGACCTGCCTTTCCCGACCACACTAAGATCGATGCAGTCTTTCCTGGGAAGTTTGAATTACTAC
AGTCGTTTTATCGAGGATTTGGCGATCTACGCTTCGATACTGTATGAGCTTCGGTAAGCAGATTTCTATGAGATCACTCAGAAGTCCAAGATCGAAGCCG
TAGCTGGGGACGATAGTAAACCTGAAGAAGATGGCAAATGGGCCAGGGCAGTCAGGGCTTTCGAAACGCTGAAGGTCAGGATCGCGACCGCGCCTATTCT
TCAGCACTTTGACTCCGACAAACAGCCCGTCGTGGTTTTGTACGCCAGCAAGCGGGCGATCTCAGCAGCCTTGATGCAGGAACAAGATGGTATGTACCAG
CCTGTGACCTTTACAAGCCGAATGCTTAAGCCGAACGAGATCAACTACGGGATTGTGGATAAAGAGGTGTTGGCGCTTCTAAGAATCTTGGGCGTTTGCT
ACACTCAATTGGTGACAAGGTCGATCAAAGAGTTGACTCGACATTCAACGTTGGGTTGGCTGTTGCATTCGTCAGGTCTACAAGGACGACTAGGAAATTG
GGCTGCCCTTCTCTCGAGCTGGACGCTAGAGATCGTCAAGTGCACCAAAGGCGAGGATGAGATCTTGGGAGTAATCTCGGCTAGCATCACCCCACGTGCC
GAAGTGGACGCGATCTTGACGTCGATTGCACCAAGAAAGCAGCCGAGGCAAGTCACCACGATGCAGCCGCCCACTGTGGAACCAGACGAGAAGTTGCTGG
TGGTTAGTTTCGATGGGTCGGCTCGTGTGAAACGCAGTGGAGGTGCATATAGCGCGATCGTATGGAGCTTACCTCAATGGACAGTGGTAGCAGCAGCGTC
CGAGTATAAGGCCGATCTTACCGTCAATGAGGCAGAGTACCACGGTCTACTACTCGGTTTTAAGCTCGCGTCTGACCTAGACAGGGGACGGCTTGTTATC
TGCGGCGACTCAAACCTGGTGATTCGGCAGATGCGTGGGGAGATCGAATGTAAGGCGCCGAGTCTGAAATTGCTCCGGCAGAAAGCCATCGAGCAGTTGC
GATCTTGGCCGGAACATGAATTTTCTCCATGTGAAAAGAGACTGGAACCAAAGCGCTGATAGTCTCGCGAGTGCGGCACTGCAAAAAGGAAAAGGCTACG
TGATCATGTCTGGTGCTGGCCGGGACGATTTGATAACGCTCAACCGCCTGCTAGAGTTATTGGTCGCTCGATCTGACGAGGCGGTACCTAAGATCGCAGC
CATCTCAAGATCGCACCGGCGACGCAGGCCTGAAGTGTTACAGGAAGCCGTTGTACAGCGAGTACGAATGGATCGAATTGCTCGAGCTCAAGGTGAGAAG
TGGTCTGCGGACTTCAAGAGGTATTTGCGAGGGGACGTGCAGGATCTGTCAGCGTCGGAAGCTAAAACTTATGCCAAGATCACAGAAGATTACGAGATCG
TCGAGGCCGGCCTACTCTTCTACTGTCCTCCATCCAAACAATCTGATGAAGATCGCGACCTCGTGATGAGGTTAGTGGTACCAGAATCGTTGCAAAACGA
CTTTCTTCATCACTACCACACCAGTGTGGAAGGTGGACATCAAGGTATTGGGAGGATCTACCAGCAGACTTTCACCGAAGAGGACTATACCTGAGTGTGC
AACGCTATGGGGGGGAGTGTGTAGACTGTGAGACTGGGAAAGGAAGACCGTCAATCCTAGGTGAATCACCTGGAAAGCTTCAAGCGACCTACCCTTTCCA
GGTTATTGCTATCGACCATGTTCCGTCGTTGCCTAAGTCGTATAAGGGTAACACGGAGTTGTTGATCTGGGTGGATCTCTTCACAGGGTTCGTGATCGCT
GGAGCCATTTCCTCAAGGACTGATCAGACTATTGCAGAAAACTACGAAGAGTGTGTGTTACGTCGATTTGGTGCAAGTGAGGCGATCAGGCATGACCGAG
AACCTGGCTTCATATCCGATTTCTTCAGATCGTTCAACAGGATCGTTGGCCAAAAATAGCGAGCGACTATGGCGTATCGTCCTCAAGCCAACGGCACAGC
AGCGCACATAGTACAGACATTAACACGTGCTCTCAAGATGTACGTGACTGATGTAAACCAGAAGAATTGGGATGAATACGTGGAACGGTTGACTTTCGCA
CTCAATACGGCTCAAGATCATGTTCGTGATGACACGCCGTTCTACATAGTTTATAGATGAGATCCTCGATCTACGTTGGAAGCTGCGATTCCTCTAGGGT
CGACACGACGTCGAGATCGAGAACCCTGCCGGTGGCGTTATTATATCCAGAAACACAATCATCAGGCTCGCGAACAAGTTTTGAACATCTGAGCGAAGCT
ATCAAAGAGAGAGAGGAGATCGGCATAACGAGTGACCCGACCACACAAGATCGAGGTTGGCTCACAAGTATGGATGTACCTAGATCGCGTAAGGAGGAAT
ATGCGCGTAAACGGGCACACATGTGGCATGGACCGTTCCGAGTCACGCAGCTAATCATGC