Description :
From Genome Similarity Track
Location :
Scaffold_58:2635- 4969
Transcript NameFunction/comments
g10905.t1XP_009514637.1 hypothetical protein PHYSODRAFT_462863, partial [Phytophthora sojae

Sequence
2334 bases(100 bases per row)
CTATATGGATTAATGTAACGGGGTACACCGACGTGTACCCTTGTTGCATAAAGAGTGACGGGACGTCCCTCTTTAGTGTCTATGGTACGTGGTACCGGTT
GGCGGTGAGCCAACCATTGGGCACTTGTTTAGCTTTTACTATAGTTTGTAAGGATCAAGCTTGACTCACCTATAAATATATTCAGTCTTTAACCTACCGT
CTAAGTCATAGTCGGTTCCCTTAGACCGGGAACCGTGAACTTGTTGTTCACCGAGAGCTTACGCTTTCTAGCACTTCCTCTGTGCAAGCTGCTGTGTGCC
CCGTCACACTTGGTAGCACTTGTAGTCAATCCACGCCTACGCGGGTAGGATTGAACTACCTGAATCCTCTGTGATCTCAAAGCCTGAGCCACTATGGAAC
GAAGTGAGTTTCCTCACTTGAACGACTCGCAGTTCGAGTCCGTTCGAAAGATGGGAGGCATCTTTGGGAGGGATGTCCTCCGAGGCTTGGCGTCGGTGAC
GCCAGCCGAGCAAGTCGAACGCGTGAATGCGTTCGACACGTATGAGCGTGAGCTCATTGCTCACGTGCAGGGAAACCTGCAGGCCTCTGTGGCCGAGCCG
AAGCCGGTTCAGCCGAAGCCTTTGCGGCTGGCTGTGCCTGCGTTCGAAGGGAAGGAAGGGGAAAACCTTCACTTCTGGATCCGAGAAGTTGAGATCGCCA
TGAGGGCGGGTCTCATCTCGGATCAGGGACTTCGCGTTGCGTTCGCGTTGTCCAACCTAAGCGATCGTGCCAAGAATTGGGCGTACATGCTGGAGACGAC
GTCTCCTGGATGCTTTGCATCCTGGGAACAGTTGTGCGAGCGGCTTCGCGCTGCGTTTCTCCCGGCGAACGATGCGTTCCGCCAGCGCTCACGCTTCCTC
GCCTGTAAGCAAGGGAAGCGCGAGCTGTACGAGTACGTACAAGAGATGCGCACGTTGGCATCATCGTTGGTGGGGAACCCCCTGCCCGAAGATGTCAAGA
CGACGGTCTTCACGGACGGCCTGAAGGTCGGTCCCGCACGCACGCAGCTATTCCGCGTGCATGCATCCACTATGGAGGAGGCGATTAAGATCGCCCTCCA
GGAGGAGTACAGCCATAAGCAGGCTGGTACTCCGGTTGTTGCGCAACTTGTCGTCGCGAACAACGAGCCAGAGCCTATGGACTTGAGCTCTGCTGAGCTT
GGCTTGGTCCGCTGCTATAAATGCGGCGGACTAGGACACTACCAACGTGTGTGTCCTTCGACTGGGGTGGGGAAGAACCCATCCCTCAAACCCCGAGGGC
CTAACGGTCGCTGGCGCAAGCCGCGGCCAGGTGGCCGAGGGAACTCCGGCCACAAGTAATGGCGGGTTCCCCAGAGGGGGGAGAGTTGAGTCTCCGTGAC
GGGTGTGCGGGTGGCGCACACCATGGAGGCTTAGCCTACGAGAGACATTATGTCTCGAATCGGTGATGGCAAAGCTGGGTTGCCGTTAGTACACGTGAGT
GTACGGGGATGTTAATATCCCTAGGAACGTTTAGTTCCAGGGGCGTCGAATGCTTTCGTACGCCGCCGGAGCGATTGCCAACTCTCTGTGAGAGAGCATC
GGCAATGGTCTGCATAGACCTTGCTGTCAGGTTCACATACCTGAACAGCTGCGACCCGTACGTGGTCGTGGACACGTACGGCGTCCGCTTGGGTGCGCCG
TGCCATGAACGCACGCACCCTGAAGCAATTGGTGTCGGAAAGCCATCTAGGCTAACCGGCACCCAGCTTCTGGCAGAGCATTGGTGAGTCATGACCCCAC
CTCTGCCAGAACACGCGGTATCCGAAAGGATTACCAGGACGCAATGGCGTCCGCCGACGTACGGAAGTCGTCGGAGTAGTTGCAGCTGCAACAGGTGTTG
AGACACCGTTCACTGCGGGCAATGGACCGCCACAGGCAATGCCGGTAGACAGGACTAATAGTCCAGCGAGGGGAGCTGCAACGCCAGCAGCACCCACCGC
TCCTGATCGTGGCGCCATACAGGCCTCGACTGTATCAGCGCCAGGGGATGTCAGCTCCCCAGTAGAACAAGTCCACGTGAGGCCAAGACGGTCGAGACCG
TGGCCAGGGCTGAGGTTGCCGAGAGCACCTCCTGTGTGGGTAACAATGTGCCACACGGAGTCGATGAGATTCCCGACTCTGCCCTTGAGTCACCACCGGC
CGTGGGTAACGAAGAACCACGCCGGGGTAGGCATTGACGACGTCGTCGCCGCCGTAAGCCGAGTCTGTTGAAACAGACTGGAGTCGCCACGAGCGACTCG
GAGTAATCAACGCTCCTCAGGCACGGCCGGCCGA