Description :
From Genome Similarity Track
Location :
Scaffold_10:26347- 27571
Transcript NameFunction/comments
Phypl_g439conserved hypothetical protein

Sequence
1224 bases(100 bases per row)
GCCCCGAGAtcctcgtgctggccaagtactTTCGCTGCCTGCAGATCGCCATCTCCTGCGTGCTGTACGGAAAATCCGCCGGGGAACTCGTTAATCGGAC
GAAGCTGGTATGTACAGGGGTNGGGGGGGTAGAGCATGATAGCGTTGACGATCCTGATCCtattttgctgctgctgctcgacagtTCTATAACATGCTCA
TCCCGATGGTGGGGCTGGCCACGATCGCCATGACGGtggatgcgctgctggttgtcgtAGTctacgacgagatcgactgCCACCACATTACGTGGGTGGC
GATGTCGGTAACAGGGGTTGTTCTCACAGGTATGCGTTTGGTGCAGATCAAACCCAGAGAGTGCTGTGGTGGAGGACCGAGTACTGACTGTATTTGCTGT
GGGCAGCTGGATTTGCTATCCCTGGTCGAGTGGTTCTGGAAGAGATCAACTCCACAGCACGAAAACAGGTACGCCTGACGGCGGGTATTTCCATGTTAAT
TTGCCCCAAGCGCTGACGCTTGCCTCTCCAGCGCACGAAATTCCAGGATTCCGCCGAGCTAACCGAATTGGAGCAGTCACACCATCAGCTGTGGGTTCTC
CTGATCGTAAGTGGGTCTGCTGGTGGTGATCGTTGTCCTTGATCTCGAGTGCCTTTCGATGGCTAACATGCGCGTTTATTCTCTCACTTGCGCGAACAGT
GCAACCTCGTGAGCAcgagcttgcagctcgcagTGGACGCATACCTCTCGTTTGGTGTCGGCGGTGAGGACGGATGCAATGCTCCTGGACTTTAGGTGGC
GTAGGGAAACTAAACGGGTTGGTGCTGGCACATGTaggcaagaagcgcgagtgTGACAGCATGttcttcgacgagaacggcgGGCTCTTCGAGCAGTCGG
TGCGCTTGACGATCTCTATCGGGACGTACCTCGTGCCGAACTGGGGCGTGCTGTACGTCTTCTATGTGCTACCGCGCTTCCAGTTCTCCACGGTTCTGGA
CGTGCCCGGgctcctgctcgacgacgagggcgaggaaACGGCTTATGAACTCCTTCccggcgacgagcgcgtAGTGCCCACCAGCGGAAGTGGTCGATGG
AGACGATTCTACTGAAAATGCGACTGTAAAATAACTAGGTGCTTGGTTGAAGCGGGACGCGATAGATGACTAATGATCGGGTGCGGGCCAGCGCAACCCG
ACACGGTCTACTGTACGTTGAATA