Description :
From Genome Similarity Track
Location :
scaffold_85:2634- 4815
Sequence
2181 bases(100 bases per row)
GTAGCATGAGGTTGTTCTGGCGCGCCGTTGGTCTAATGGTTAGGATTCGTCCCTCCCACGGACGAGGTCGGGGTTCGATTCCCCGACGGCGCACGCCTTC
CTTATGCCTCGCGTTTTGCGTTTTGCGTCTTGCGTTTTACGTCTTGCGTGAGCGTATGGCTACCGCAGGCGAGCCACGTACTAATCGCCTCACGAACCGA
CTGGCGTGTGTGCTGCTCTCTGTCGTTGGCTGAGCTCAGGGTGTTTTGTTGCTTGGTGCACCTTTTGTCATTTCTTCTGAGGCTTATTACCAGGCCTCCA
AGAGACTCGGAGGTCTACTACTGTCCTCCTCCAAGCTCCGATAACCCGGACAATCATCAAACGCAATCACAGCAGCATCTGACATCGAGTCGAGGCGAAA
CGCGAGTGATGCGGTATCGGTCCACCACGGCATTGGATACTTGGCTCCGAAGCCTTGTTCAGCAAGAGCAAGAGTGTCTTGCCTCTTTGTTTGTTTGTTT
GTTTGCTTGCTTGTTTGTTTGTTTGTTTGCATGTCGCGTTGTCGTCTCGATATGGCGTCATAGATGGAAGTGAACATGTATGCATACACCAAATGGCGGT
TGTTGTGCAAGTCACTGCATCTCCCCCTCTTCCTGCCGCTCTCGTGTGAGGAGCAAGTGACGTACGTCGGTTTATGGCCAGTCTGGCATAAATCAACAAC
AACGACACAACGTAGCTCCAGCTATTCATCTACGCCCACATACCCGCAAGGGCAGTAATATCACCACTACGGAGTGAGTAGAGTCGACAGAGCTTCCATA
ATGAAGGAAGAGGGAAGAGAGGGAGGGAGGGAGGGAGGGAGGGAGGAGGAGGAAGGAAGGAAGGAAGGAAGGAAAGAAGGGAGGAGGCCTTGAATCGGTG
ACAACCTGTCCGCTCGTCGATCAATATATGTTTCTTTCAAAATGGACATCGGACGATAGTACACTGGCGCACAGTGGTGCTCGGTATAGCAGGGTTGGAC
GGGACAGGGCGAGGTAAGGCAAGCGTCGGAGCGATTGGAGCGGTGAGAACAGTGAGGTATGTAGGTTGGCAGGCAGGCGGGTGGACAGACACGTAGGCAG
ACAGGTAGACAAGGGCCAGTGGGTGTGGCGTGGGGTGGTACTCATACTCAGGTGTGGTGGTACTCATACTCAGGTGTGGTGGTACTCAGGTGTGGGTAGT
TGTATTGCACGTTGTGGTTTCGTTTTACGTGCATGAAAGTTGGTGTGGTGTAGGCGTTTGGTTGGTTGGTTGGCCGTGCGGTGAGTTGGTTTGTTTGGAT
TGTTTGGTTTGTTTGGTTTGGTTTGTTTGTGATTGCATGCGCTGAGTATGTGTGAATGTTGTGGTGTTTATGTGTATATGGTGTGCTGTGCACCGTTGGT
CTAATGGTTAGGATTCATCCCTTCCAAGGATGAGGTCGGGGTTCGATTCCCCGACGGCGCAACTTTTGCCTCTCTTAGCCGCGTCGCTTCCCATCTTGTA
CCTTGTTTGGAGCGCTTACCTACGCGTCCTTACATATGTACATGCGTGTCCAACCTACAGGCCATCCCAGCACCTCATATCTCCTTTGTGGATGCGTGCA
AAAGCAAGTGAATACCAGACGTCGTTTCACGCTTCCACGGGCTTACAACGTCAAAGCACTCGGCCCTGGGCCCTGGGCCCGGGGCACTGGGCACTGGGCC
CTGGGCGGAGGCAGTGTGGGGGTGTCGCTTGATGCGGCATGATTTTGGATTGGGTAGCGGTGAGGTCGTGCGTGTATGTTTTGCTGTGTATTTGTCTAGG
GTTGTGGTTCTGTGGGTGTTCGTTTTGGGGTAGCATGAGGTTGTTCTGGCGCGCCGTTGGTCTAATGGTTAGGATTCGTCCCTCCCACGGACGAGGTCGG
GGTTCGATTCCCCGACGGCGCACGCCTTCCTTATGCCTCGCGTTTTGCGTTTTGCGTCTTGCGTTTTACGTCTTGCGTGAGCGTATGGCTACCGCAGGCG
AGCCACGTACTAATCGCCTCACGAACCGACTGGCGTGTGTGCTGCTCTCTGTCGTTGGCTGAGCTCAGGGTGTTTTGTTGCTTGGTGCACCTTTTGTCAT
TTCTTCTGAGGCTTATTACCAGGCCTCCAAGAGACTCGGAGGTCTACTACTGTCCTCCTCCAAGCTCCGATAACCCGGACA